Incidental Mutation 'R0575:Olfr10'
ID201508
Institutional Source Beutler Lab
Gene Symbol Olfr10
Ensembl Gene ENSMUSG00000100923
Gene Nameolfactory receptor 10
SynonymsMOR256-55, L45, GA_x6K02T2QP88-6117098-6116163
MMRRC Submission 038765-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R0575 (G1)
Quality Score77
Status Validated
Chromosome11
Chromosomal Location49304741-49320021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49318053 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 169 (C169Y)
Ref Sequence ENSEMBL: ENSMUSP00000149724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187570] [ENSMUST00000215671] [ENSMUST00000217290]
Predicted Effect probably damaging
Transcript: ENSMUST00000074358
AA Change: C169Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073963
Gene: ENSMUSG00000057168
AA Change: C169Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 9.5e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 222 4.7e-7 PFAM
Pfam:7tm_1 41 289 6.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000187570
AA Change: C169Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139744
Gene: ENSMUSG00000100923
AA Change: C169Y

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 35 222 4.7e-7 PFAM
Pfam:7tm_1 41 289 1.3e-33 PFAM
Pfam:7tm_4 139 282 4.6e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215671
Predicted Effect probably damaging
Transcript: ENSMUST00000217290
AA Change: C169Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3371 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,591,252 S264N possibly damaging Het
Acsm1 G A 7: 119,659,201 probably null Het
Adsl C T 15: 80,963,685 A93V probably damaging Het
Agbl5 A T 5: 30,894,454 S539C probably damaging Het
Aggf1 T A 13: 95,368,397 T285S probably benign Het
Anapc11 A G 11: 120,599,366 D36G probably benign Het
Ankrd44 G A 1: 54,762,310 A286V probably damaging Het
Atf7ip2 G T 16: 10,237,211 G281C probably damaging Het
Birc6 A G 17: 74,689,237 K4475E probably damaging Het
Ccbe1 T A 18: 66,093,995 probably benign Het
Cyp26b1 A G 6: 84,575,306 probably benign Het
Dcun1d1 T C 3: 35,897,785 probably benign Het
Dtwd2 C A 18: 49,698,472 C156F probably damaging Het
Efcab6 T G 15: 83,967,700 I326L probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
F5 C A 1: 164,176,244 Q203K probably damaging Het
Frs3 A G 17: 47,703,723 H447R possibly damaging Het
Gmds T G 13: 31,940,583 Q264P probably damaging Het
Golgb1 T A 16: 36,918,809 D2503E probably benign Het
Lgi4 G A 7: 31,060,093 G25R probably benign Het
Olfr1461 T A 19: 13,165,387 Y124* probably null Het
Pcdh20 A G 14: 88,467,612 S751P probably damaging Het
Pcnx4 A G 12: 72,567,236 T652A probably benign Het
Pom121l2 T G 13: 21,984,168 F870V probably damaging Het
Prob1 T C 18: 35,654,721 D160G possibly damaging Het
Spa17 T C 9: 37,603,393 K133E probably damaging Het
Strbp T A 2: 37,640,873 D123V possibly damaging Het
Tnxb A G 17: 34,717,206 T3586A possibly damaging Het
Zfp518a T A 19: 40,912,315 H229Q probably damaging Het
Other mutations in Olfr10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Olfr10 APN 11 49318300 nonsense probably null 0.00
IGL02283:Olfr10 APN 11 49318335 missense probably benign
IGL03010:Olfr10 APN 11 49318146 missense probably damaging 0.99
R1430:Olfr10 UTSW 11 49318101 unclassified probably null
R1891:Olfr10 UTSW 11 49317857 missense probably benign 0.00
R2509:Olfr10 UTSW 11 49318221 missense probably damaging 0.97
R2511:Olfr10 UTSW 11 49318221 missense probably damaging 0.97
R4942:Olfr10 UTSW 11 49317548 start codon destroyed probably null 0.99
R5080:Olfr10 UTSW 11 49318087 missense probably benign 0.03
R5413:Olfr10 UTSW 11 49318413 missense probably damaging 1.00
R5843:Olfr10 UTSW 11 49318249 missense probably benign 0.34
R6354:Olfr10 UTSW 11 49317638 missense probably damaging 0.98
R6605:Olfr10 UTSW 11 49317714 missense probably damaging 0.97
R8005:Olfr10 UTSW 11 49318141 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CATCATTGCTCTCTCCCGAACAGAC -3'
(R):5'- TACTGACTTGACCTTCAGCACCGC -3'

Sequencing Primer
(F):5'- CCATCAGCTATGGAGGCTGTG -3'
(R):5'- ACCGCCCTAGCAATCTGTG -3'
Posted On2014-06-16