Incidental Mutation 'R0575:Gmds'
ID201509
Institutional Source Beutler Lab
Gene Symbol Gmds
Ensembl Gene ENSMUSG00000038372
Gene NameGDP-mannose 4, 6-dehydratase
Synonyms
MMRRC Submission 038765-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0575 (G1)
Quality Score66
Status Validated
Chromosome13
Chromosomal Location31819579-32338740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 31940583 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 264 (Q264P)
Ref Sequence ENSEMBL: ENSMUSP00000036696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041859]
Predicted Effect probably damaging
Transcript: ENSMUST00000041859
AA Change: Q264P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036696
Gene: ENSMUSG00000038372
AA Change: Q264P

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 24 229 4.3e-8 PFAM
Pfam:Epimerase 26 274 2.2e-76 PFAM
Pfam:GDP_Man_Dehyd 27 358 7.2e-167 PFAM
Meta Mutation Damage Score 0.9691 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GDP-mannose 4,6-dehydratase (GMD; EC 4.2.1.47) catalyzes the conversion of GDP-mannose to GDP-4-keto-6-deoxymannose, the first step in the synthesis of GDP-fucose from GDP-mannose, using NADP+ as a cofactor. The second and third steps of the pathway are catalyzed by a single enzyme, GDP-keto-6-deoxymannose 3,5-epimerase, 4-reductase, designated FX in humans (MIM 137020).[supplied by OMIM, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,591,252 S264N possibly damaging Het
Acsm1 G A 7: 119,659,201 probably null Het
Adsl C T 15: 80,963,685 A93V probably damaging Het
Agbl5 A T 5: 30,894,454 S539C probably damaging Het
Aggf1 T A 13: 95,368,397 T285S probably benign Het
Anapc11 A G 11: 120,599,366 D36G probably benign Het
Ankrd44 G A 1: 54,762,310 A286V probably damaging Het
Atf7ip2 G T 16: 10,237,211 G281C probably damaging Het
Birc6 A G 17: 74,689,237 K4475E probably damaging Het
Ccbe1 T A 18: 66,093,995 probably benign Het
Cyp26b1 A G 6: 84,575,306 probably benign Het
Dcun1d1 T C 3: 35,897,785 probably benign Het
Dtwd2 C A 18: 49,698,472 C156F probably damaging Het
Efcab6 T G 15: 83,967,700 I326L probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
F5 C A 1: 164,176,244 Q203K probably damaging Het
Frs3 A G 17: 47,703,723 H447R possibly damaging Het
Golgb1 T A 16: 36,918,809 D2503E probably benign Het
Lgi4 G A 7: 31,060,093 G25R probably benign Het
Olfr10 G A 11: 49,318,053 C169Y probably damaging Het
Olfr1461 T A 19: 13,165,387 Y124* probably null Het
Pcdh20 A G 14: 88,467,612 S751P probably damaging Het
Pcnx4 A G 12: 72,567,236 T652A probably benign Het
Pom121l2 T G 13: 21,984,168 F870V probably damaging Het
Prob1 T C 18: 35,654,721 D160G possibly damaging Het
Spa17 T C 9: 37,603,393 K133E probably damaging Het
Strbp T A 2: 37,640,873 D123V possibly damaging Het
Tnxb A G 17: 34,717,206 T3586A possibly damaging Het
Zfp518a T A 19: 40,912,315 H229Q probably damaging Het
Other mutations in Gmds
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Gmds APN 13 32234390 missense probably damaging 1.00
IGL01021:Gmds APN 13 32127030 missense possibly damaging 0.85
IGL01463:Gmds APN 13 32234358 missense probably damaging 1.00
IGL01780:Gmds APN 13 32225162 nonsense probably null
IGL02570:Gmds APN 13 32234407 splice site probably benign
IGL02944:Gmds APN 13 32338452 missense probably benign
IGL03159:Gmds APN 13 31819951 missense probably damaging 1.00
Insipidus UTSW 13 31917696 missense probably benign 0.21
mini UTSW 13 31820189 missense possibly damaging 0.77
R0114:Gmds UTSW 13 32227281 missense probably benign 0.09
R1932:Gmds UTSW 13 32127997 missense possibly damaging 0.87
R2516:Gmds UTSW 13 32100473 missense probably damaging 1.00
R3877:Gmds UTSW 13 32227265 missense probably damaging 1.00
R4257:Gmds UTSW 13 31820189 missense possibly damaging 0.77
R4380:Gmds UTSW 13 31917696 missense probably benign 0.21
R4441:Gmds UTSW 13 31940478 splice site probably null
R5060:Gmds UTSW 13 31940499 missense probably benign 0.01
R5454:Gmds UTSW 13 32128041 missense probably damaging 1.00
R5493:Gmds UTSW 13 31940505 missense probably benign
R5571:Gmds UTSW 13 31917721 splice site probably null
R6795:Gmds UTSW 13 32234352 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GACTCATAAGGGCCTCTTGCATCAC -3'
(R):5'- CCAGGTGTTCACACCAAGATGTTTCTC -3'

Sequencing Primer
(F):5'- TTATAAGAGGCTGAGAGAAGGTGATG -3'
(R):5'- ACCAAGATGTTTCTCGGGTTTTTC -3'
Posted On2014-06-16