Incidental Mutation 'R0090:Zfhx3'
ID20151
Institutional Source Beutler Lab
Gene Symbol Zfhx3
Ensembl Gene ENSMUSG00000038872
Gene Namezinc finger homeobox 3
SynonymsA230102L03Rik, Atbf1, WBP9
MMRRC Submission 038377-MU
Accession Numbers

Genbank: NM_007496

Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R0090 (G1)
Quality Score225
Status Validated (trace)
Chromosome8
Chromosomal Location107942644-108961630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108950057 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 2580 (D2580N)
Ref Sequence ENSEMBL: ENSMUSP00000152353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043896] [ENSMUST00000220518]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043896
AA Change: D2580N

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044612
Gene: ENSMUSG00000038872
AA Change: D2580N

DomainStartEndE-ValueType
ZnF_C2H2 79 103 7.89e0 SMART
low complexity region 110 127 N/A INTRINSIC
low complexity region 148 165 N/A INTRINSIC
ZnF_C2H2 282 305 1.36e1 SMART
low complexity region 393 411 N/A INTRINSIC
coiled coil region 453 496 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
ZnF_C2H2 641 664 3.47e0 SMART
ZnF_C2H2 672 695 6.78e-3 SMART
ZnF_U1 724 758 5.71e-1 SMART
ZnF_C2H2 727 751 4.87e-4 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 796 804 N/A INTRINSIC
ZnF_C2H2 805 829 6.67e-2 SMART
ZnF_U1 982 1016 2.35e0 SMART
ZnF_C2H2 985 1009 4.57e0 SMART
ZnF_C2H2 1041 1065 3.99e0 SMART
ZnF_U1 1086 1120 1.36e0 SMART
ZnF_C2H2 1089 1113 1.33e-1 SMART
ZnF_C2H2 1233 1256 4.11e-2 SMART
ZnF_C2H2 1262 1285 4.34e-1 SMART
ZnF_C2H2 1370 1395 1.08e-1 SMART
ZnF_C2H2 1411 1433 3.34e-2 SMART
ZnF_C2H2 1439 1462 8.09e-1 SMART
low complexity region 1500 1512 N/A INTRINSIC
ZnF_U1 1552 1586 1.05e0 SMART
ZnF_C2H2 1555 1579 8.22e-2 SMART
ZnF_U1 1603 1637 4.19e0 SMART
ZnF_C2H2 1606 1630 1.16e-1 SMART
low complexity region 1643 1669 N/A INTRINSIC
low complexity region 1734 1776 N/A INTRINSIC
low complexity region 1792 1802 N/A INTRINSIC
low complexity region 1842 1878 N/A INTRINSIC
low complexity region 1881 1894 N/A INTRINSIC
low complexity region 1967 1985 N/A INTRINSIC
ZnF_C2H2 1990 2013 1.62e0 SMART
low complexity region 2041 2088 N/A INTRINSIC
low complexity region 2110 2125 N/A INTRINSIC
HOX 2152 2214 1.13e-16 SMART
HOX 2249 2311 2.41e-20 SMART
ZnF_C2H2 2335 2355 1.72e1 SMART
low complexity region 2383 2414 N/A INTRINSIC
low complexity region 2458 2473 N/A INTRINSIC
low complexity region 2476 2521 N/A INTRINSIC
ZnF_C2H2 2539 2561 1.79e-2 SMART
low complexity region 2606 2619 N/A INTRINSIC
HOX 2650 2712 2.97e-20 SMART
ZnF_C2H2 2720 2743 7.67e-2 SMART
low complexity region 2929 2950 N/A INTRINSIC
HOX 2954 3016 1.07e-17 SMART
ZnF_U1 3029 3063 1.8e-1 SMART
ZnF_C2H2 3032 3056 8.31e0 SMART
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3181 3235 N/A INTRINSIC
low complexity region 3237 3256 N/A INTRINSIC
low complexity region 3268 3282 N/A INTRINSIC
low complexity region 3290 3299 N/A INTRINSIC
coiled coil region 3362 3417 N/A INTRINSIC
low complexity region 3452 3476 N/A INTRINSIC
ZnF_C2H2 3489 3509 1.45e2 SMART
ZnF_U1 3546 3580 1.36e0 SMART
ZnF_C2H2 3549 3573 1.77e1 SMART
low complexity region 3602 3633 N/A INTRINSIC
low complexity region 3642 3674 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000220518
AA Change: D2580N

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.0894 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.7%
  • 20x: 91.4%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor with multiple homeodomains and zinc finger motifs, and regulates myogenic and neuronal differentiation. The encoded protein suppresses expression of the alpha-fetoprotein gene by binding to an AT-rich enhancer motif. The protein has also been shown to negatively regulate c-Myb, and transactivate the cell cycle inhibitor cyclin-dependent kinase inhibitor 1A (also known as p21CIP1). This gene is reported to function as a tumor suppressor in several cancers, and sequence variants of this gene are also associated with atrial fibrillation. Multiple transcript variants expressed from alternate promoters and encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal initial pituitary development but reduced GH and TSH-beta staining within the pituitary by E17.5. Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice heterozygous for the same allele exhibit partial postnatal lethality, decreased body size and prolonged conception time. [provided by MGI curators]
Allele List at MGI

 All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
4933427I04Rik A G 4: 123,860,982 T230A possibly damaging Het
9230110C19Rik T A 9: 8,027,183 N118I probably benign Het
Acsm1 T C 7: 119,662,189 probably benign Het
Acta1 T C 8: 123,893,657 N14S probably damaging Het
Aff4 A G 11: 53,392,782 T362A probably benign Het
Aggf1 A G 13: 95,364,959 I305T probably benign Het
Ap4b1 A G 3: 103,820,429 D325G possibly damaging Het
Ap4e1 C T 2: 127,064,985 T1055I possibly damaging Het
Arhgef2 A T 3: 88,639,348 Q496L probably damaging Het
Arhgef28 A G 13: 98,075,110 F122L probably damaging Het
Baiap3 G A 17: 25,250,070 probably benign Het
Casp8ap2 T A 4: 32,640,327 H460Q probably damaging Het
Casz1 A G 4: 148,933,411 T386A probably benign Het
Cd53 A T 3: 106,767,409 V114E possibly damaging Het
Celsr2 A G 3: 108,393,327 probably benign Het
Chaf1b G T 16: 93,887,124 A88S possibly damaging Het
Cldn10 A T 14: 118,874,200 Y194F probably damaging Het
Clec2e A C 6: 129,095,218 probably null Het
Cmpk2 A T 12: 26,478,022 T413S probably benign Het
Col9a1 T A 1: 24,223,562 probably null Het
Dchs1 G T 7: 105,755,932 Q2468K probably benign Het
Ddx60 A G 8: 61,942,293 D88G probably damaging Het
Dnah8 A G 17: 30,784,090 R3588G probably benign Het
Ect2 C T 3: 27,138,502 E431K probably null Het
Ect2 T C 3: 27,115,476 T774A probably benign Het
Ern1 A G 11: 106,405,823 V767A probably damaging Het
Fbln1 A C 15: 85,224,288 E75A possibly damaging Het
Fgf5 C T 5: 98,261,987 R132* probably null Het
Folh1 T C 7: 86,725,868 probably benign Het
Gdf15 A T 8: 70,629,684 H257Q probably damaging Het
Ghitm T C 14: 37,122,219 T322A probably benign Het
Gm13212 A T 4: 145,622,625 K211* probably null Het
Gm5709 A G 3: 59,618,771 noncoding transcript Het
Hbb-y C T 7: 103,852,743 probably null Het
Hmcn2 A T 2: 31,426,198 D3771V probably damaging Het
Hspa12a T C 19: 58,799,509 D627G probably benign Het
Idh2 T C 7: 80,097,914 E286G probably damaging Het
Idh3b C A 2: 130,280,979 A297S probably benign Het
Igsf3 A G 3: 101,435,652 E535G probably damaging Het
Ilf3 T A 9: 21,395,414 D314E probably damaging Het
Itgb8 A G 12: 119,202,563 S78P probably benign Het
Itih5 G A 2: 10,164,684 V31I probably benign Het
Kcnj2 T C 11: 111,073,027 V415A probably benign Het
Kin A G 2: 10,085,773 Q53R possibly damaging Het
Krt78 A T 15: 101,947,837 M513K probably benign Het
Krtap4-8 A T 11: 99,780,486 probably benign Het
Ltbr T C 6: 125,309,449 probably benign Het
Mgat4a G A 1: 37,490,333 T146I probably damaging Het
Mrps2 G C 2: 28,468,256 W19C probably damaging Het
Mthfs T C 9: 89,211,291 S33P probably damaging Het
Myh6 T C 14: 54,958,704 D546G probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Ndst2 T C 14: 20,727,267 T553A probably damaging Het
Nlrp12 T C 7: 3,240,034 E616G probably damaging Het
Nrde2 T C 12: 100,129,286 probably benign Het
Nup210l G A 3: 90,211,779 V1832I probably benign Het
Olfr1283 A T 2: 111,369,294 I221F probably damaging Het
Olfr376 G A 11: 73,375,576 V276I probably benign Het
Pcm1 A T 8: 41,256,041 E9D probably damaging Het
Pear1 A T 3: 87,754,342 D541E possibly damaging Het
Peg10 A G 6: 4,756,063 probably benign Het
Prss1 G A 6: 41,461,232 R31Q probably benign Het
Ptpn13 T C 5: 103,569,503 V1837A probably damaging Het
Rasgrp3 A G 17: 75,498,461 D149G probably damaging Het
Reg3d A T 6: 78,378,483 H8Q possibly damaging Het
Rhox4f A C X: 37,607,469 V15G probably benign Het
Sacs T A 14: 61,205,440 L1645H probably damaging Het
Slc16a5 A T 11: 115,464,925 S71C probably damaging Het
Slc9a3 A G 13: 74,158,728 E324G probably damaging Het
Smgc T C 15: 91,859,762 V574A possibly damaging Het
Stac3 C T 10: 127,503,930 probably benign Het
Supv3l1 A G 10: 62,429,706 L685P probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tas2r125 G T 6: 132,910,398 A250S probably benign Het
Tdrd6 C T 17: 43,628,241 V639I probably benign Het
Thap12 T G 7: 98,715,893 W423G probably damaging Het
Tmem245 T C 4: 56,899,410 I217V probably benign Het
Trip12 T A 1: 84,732,136 probably benign Het
Tshz3 T C 7: 36,768,892 V102A probably benign Het
Ubap1 T C 4: 41,379,826 S347P probably damaging Het
Usp10 C T 8: 119,953,196 Q612* probably null Het
Vmn2r72 T C 7: 85,754,876 I36V probably benign Het
Vps37a T C 8: 40,526,989 I63T possibly damaging Het
Whrn C A 4: 63,432,732 R9L possibly damaging Het
Xrcc1 T C 7: 24,570,217 Y401H probably damaging Het
Ylpm1 GCCTAAGCAGCAACCTAAG GCCTAAG 12: 85,029,040 probably benign Het
Zfhx4 A G 3: 5,243,625 N637S probably damaging Het
Zyg11a A T 4: 108,201,347 probably benign Het
Other mutations in Zfhx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Zfhx3 APN 8 108793594 missense probably benign 0.00
IGL01946:Zfhx3 APN 8 108933929 missense probably damaging 0.98
IGL01973:Zfhx3 APN 8 108947193 missense probably damaging 1.00
IGL01983:Zfhx3 APN 8 108947234 missense probably damaging 1.00
IGL02151:Zfhx3 APN 8 108793883 missense probably damaging 1.00
IGL02405:Zfhx3 APN 8 108955742 missense unknown
IGL02406:Zfhx3 APN 8 108955742 missense unknown
IGL02408:Zfhx3 APN 8 108955372 splice site probably benign
IGL02549:Zfhx3 APN 8 108800509 missense probably damaging 1.00
IGL02601:Zfhx3 APN 8 108856830 missense probably damaging 1.00
IGL02649:Zfhx3 APN 8 108793535 missense possibly damaging 0.94
IGL03027:Zfhx3 APN 8 108793188 missense probably damaging 0.98
IGL03053:Zfhx3 APN 8 108946500 missense probably damaging 0.99
IGL03168:Zfhx3 APN 8 108946500 missense probably damaging 0.99
IGL03194:Zfhx3 APN 8 108794727 missense probably damaging 0.97
IGL03248:Zfhx3 APN 8 108946550 missense probably damaging 1.00
FR4449:Zfhx3 UTSW 8 108956094 small insertion probably benign
FR4589:Zfhx3 UTSW 8 108956101 small insertion probably benign
FR4737:Zfhx3 UTSW 8 108956088 small insertion probably benign
FR4737:Zfhx3 UTSW 8 108956102 small insertion probably benign
FR4737:Zfhx3 UTSW 8 108956103 small insertion probably benign
G5030:Zfhx3 UTSW 8 108951459 missense possibly damaging 0.86
R0016:Zfhx3 UTSW 8 108950178 missense probably benign 0.02
R0330:Zfhx3 UTSW 8 108948957 missense probably damaging 1.00
R0332:Zfhx3 UTSW 8 108946623 missense probably damaging 1.00
R0398:Zfhx3 UTSW 8 108951246 missense probably damaging 0.98
R0539:Zfhx3 UTSW 8 108800509 missense probably damaging 1.00
R0546:Zfhx3 UTSW 8 108794187 missense probably damaging 1.00
R0614:Zfhx3 UTSW 8 108948539 missense probably benign 0.03
R0614:Zfhx3 UTSW 8 108948967 nonsense probably null
R0653:Zfhx3 UTSW 8 108946808 missense possibly damaging 0.95
R0718:Zfhx3 UTSW 8 108955650 missense unknown
R0825:Zfhx3 UTSW 8 108949208 missense probably damaging 0.99
R1143:Zfhx3 UTSW 8 108794411 missense probably damaging 1.00
R1319:Zfhx3 UTSW 8 108933833 missense probably damaging 0.99
R1347:Zfhx3 UTSW 8 108800698 splice site probably benign
R1412:Zfhx3 UTSW 8 108914567 missense possibly damaging 0.88
R1447:Zfhx3 UTSW 8 108948444 missense probably benign 0.03
R1530:Zfhx3 UTSW 8 108948489 missense probably damaging 1.00
R1745:Zfhx3 UTSW 8 108955862 missense unknown
R1764:Zfhx3 UTSW 8 108951644 missense probably benign 0.18
R1781:Zfhx3 UTSW 8 108793535 missense probably benign 0.01
R1917:Zfhx3 UTSW 8 108956248 missense unknown
R1956:Zfhx3 UTSW 8 108794142 missense probably benign 0.02
R2049:Zfhx3 UTSW 8 108945177 missense probably benign 0.01
R2196:Zfhx3 UTSW 8 108800253 missense probably damaging 1.00
R3085:Zfhx3 UTSW 8 108956032 missense unknown
R3765:Zfhx3 UTSW 8 108792762 missense probably damaging 0.97
R4162:Zfhx3 UTSW 8 108956987 missense unknown
R4243:Zfhx3 UTSW 8 108792320 missense probably damaging 0.97
R4380:Zfhx3 UTSW 8 108956390 missense unknown
R4433:Zfhx3 UTSW 8 108955637 missense unknown
R4509:Zfhx3 UTSW 8 108793779 missense probably benign 0.01
R4731:Zfhx3 UTSW 8 108956084 missense unknown
R4788:Zfhx3 UTSW 8 108794210 missense probably damaging 1.00
R4812:Zfhx3 UTSW 8 108947961 missense possibly damaging 0.83
R4893:Zfhx3 UTSW 8 108957007 missense unknown
R4907:Zfhx3 UTSW 8 108793354 missense probably damaging 0.99
R4935:Zfhx3 UTSW 8 108947850 missense possibly damaging 0.92
R4943:Zfhx3 UTSW 8 108948317 missense probably damaging 0.98
R5154:Zfhx3 UTSW 8 108800575 missense probably damaging 1.00
R5377:Zfhx3 UTSW 8 108951185 missense possibly damaging 0.95
R5388:Zfhx3 UTSW 8 108946814 missense possibly damaging 0.88
R5434:Zfhx3 UTSW 8 108792399 missense probably damaging 0.99
R5445:Zfhx3 UTSW 8 108956210 missense unknown
R5541:Zfhx3 UTSW 8 108948951 missense probably damaging 0.99
R5571:Zfhx3 UTSW 8 108955991 missense unknown
R5700:Zfhx3 UTSW 8 108933867 missense probably damaging 1.00
R5754:Zfhx3 UTSW 8 108800332 missense probably damaging 0.99
R5867:Zfhx3 UTSW 8 108793446 missense probably damaging 1.00
R5905:Zfhx3 UTSW 8 108793503 missense probably damaging 1.00
R5922:Zfhx3 UTSW 8 108946698 missense probably damaging 1.00
R5972:Zfhx3 UTSW 8 108950851 missense possibly damaging 0.91
R6020:Zfhx3 UTSW 8 108792527 missense probably damaging 1.00
R6028:Zfhx3 UTSW 8 108793503 missense probably damaging 1.00
R6113:Zfhx3 UTSW 8 108947421 missense probably benign 0.04
R6253:Zfhx3 UTSW 8 108955388 missense possibly damaging 0.96
R6356:Zfhx3 UTSW 8 108946619 missense probably damaging 1.00
R6800:Zfhx3 UTSW 8 108949517 missense probably benign 0.20
R6829:Zfhx3 UTSW 8 108950283 missense probably damaging 0.98
R6872:Zfhx3 UTSW 8 108800641 missense probably damaging 1.00
R6873:Zfhx3 UTSW 8 108800641 missense probably damaging 1.00
R6919:Zfhx3 UTSW 8 108800528 missense probably damaging 1.00
R6921:Zfhx3 UTSW 8 108951392 missense possibly damaging 0.53
R6925:Zfhx3 UTSW 8 108956821 missense unknown
R6927:Zfhx3 UTSW 8 108956821 missense unknown
R7152:Zfhx3 UTSW 8 108948207 missense possibly damaging 0.94
R7169:Zfhx3 UTSW 8 108951398 missense possibly damaging 0.86
R7214:Zfhx3 UTSW 8 108948861 missense probably damaging 0.98
R7378:Zfhx3 UTSW 8 108793248 missense probably damaging 0.99
R7391:Zfhx3 UTSW 8 108947843 missense probably damaging 0.96
R7442:Zfhx3 UTSW 8 108792836 missense probably damaging 0.97
R7636:Zfhx3 UTSW 8 108946809 missense probably benign 0.25
R7649:Zfhx3 UTSW 8 108951644 missense probably benign 0.18
R7699:Zfhx3 UTSW 8 108951122 missense probably benign 0.18
R7728:Zfhx3 UTSW 8 108951569 missense probably benign 0.01
R7780:Zfhx3 UTSW 8 108951651 missense possibly damaging 0.53
R7904:Zfhx3 UTSW 8 108951063 missense probably damaging 0.98
R8032:Zfhx3 UTSW 8 108951222 missense possibly damaging 0.51
R8158:Zfhx3 UTSW 8 108948721 missense possibly damaging 0.82
R8163:Zfhx3 UTSW 8 108949293 missense probably damaging 1.00
R8215:Zfhx3 UTSW 8 108950717 missense probably benign
R8217:Zfhx3 UTSW 8 108950717 missense probably benign
R8218:Zfhx3 UTSW 8 108950717 missense probably benign
R8369:Zfhx3 UTSW 8 108856816 missense possibly damaging 0.82
R8424:Zfhx3 UTSW 8 108856753 missense probably damaging 0.98
R8482:Zfhx3 UTSW 8 108947879 missense probably benign 0.02
R8504:Zfhx3 UTSW 8 108856917 missense possibly damaging 0.95
R8871:Zfhx3 UTSW 8 108950235 missense possibly damaging 0.85
RF027:Zfhx3 UTSW 8 108956098 small insertion probably benign
RF028:Zfhx3 UTSW 8 108956096 small insertion probably benign
RF029:Zfhx3 UTSW 8 108956092 small insertion probably benign
RF031:Zfhx3 UTSW 8 108956098 small insertion probably benign
RF032:Zfhx3 UTSW 8 108956092 small insertion probably benign
RF037:Zfhx3 UTSW 8 108956098 nonsense probably null
RF038:Zfhx3 UTSW 8 108956101 small insertion probably benign
RF040:Zfhx3 UTSW 8 108956101 small insertion probably benign
RF042:Zfhx3 UTSW 8 108956088 small insertion probably benign
RF042:Zfhx3 UTSW 8 108956098 small insertion probably benign
RF054:Zfhx3 UTSW 8 108956096 small insertion probably benign
RF060:Zfhx3 UTSW 8 108956088 small insertion probably benign
X0019:Zfhx3 UTSW 8 108951653 missense probably benign 0.00
X0026:Zfhx3 UTSW 8 108949145 missense probably damaging 1.00
Z1088:Zfhx3 UTSW 8 108951357 missense possibly damaging 0.72
Z1176:Zfhx3 UTSW 8 108793923 missense probably benign 0.09
Z1176:Zfhx3 UTSW 8 108800449 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAGCGGAGACTGATGAACTGG -3'
(R):5'- CAAACGCTTGTCTCTCTGAGGCTC -3'

Sequencing Primer
(F):5'- TTCAACTCGAAAGCAGAGGC -3'
(R):5'- CTGTCGTTCTCACCGGG -3'
Posted On2013-04-11