Incidental Mutation 'R0575:Frs3'
ID201510
Institutional Source Beutler Lab
Gene Symbol Frs3
Ensembl Gene ENSMUSG00000023266
Gene Namefibroblast growth factor receptor substrate 3
Synonyms4930417B13Rik, SNT2, Frs2beta
MMRRC Submission 038765-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.557) question?
Stock #R0575 (G1)
Quality Score69
Status Validated
Chromosome17
Chromosomal Location47689030-47704286 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47703723 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 447 (H447R)
Ref Sequence ENSEMBL: ENSMUSP00000108921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113296] [ENSMUST00000156118]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113296
AA Change: H447R

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108921
Gene: ENSMUSG00000023266
AA Change: H447R

DomainStartEndE-ValueType
IRS 17 110 4.31e-33 SMART
PTBI 18 110 1.23e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144979
Predicted Effect probably benign
Transcript: ENSMUST00000156118
Meta Mutation Damage Score 0.0857 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a substrate for the fibroblast growth factor receptor. The encoded protein is found in the peripheral plasma membrane and links fibroblast growth factor receptor stimulation to activators of Ras. The encoded protein down-regulates extracellular regulated kinase 2 through direct binding. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,591,252 S264N possibly damaging Het
Acsm1 G A 7: 119,659,201 probably null Het
Adsl C T 15: 80,963,685 A93V probably damaging Het
Agbl5 A T 5: 30,894,454 S539C probably damaging Het
Aggf1 T A 13: 95,368,397 T285S probably benign Het
Anapc11 A G 11: 120,599,366 D36G probably benign Het
Ankrd44 G A 1: 54,762,310 A286V probably damaging Het
Atf7ip2 G T 16: 10,237,211 G281C probably damaging Het
Birc6 A G 17: 74,689,237 K4475E probably damaging Het
Ccbe1 T A 18: 66,093,995 probably benign Het
Cyp26b1 A G 6: 84,575,306 probably benign Het
Dcun1d1 T C 3: 35,897,785 probably benign Het
Dtwd2 C A 18: 49,698,472 C156F probably damaging Het
Efcab6 T G 15: 83,967,700 I326L probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
F5 C A 1: 164,176,244 Q203K probably damaging Het
Gmds T G 13: 31,940,583 Q264P probably damaging Het
Golgb1 T A 16: 36,918,809 D2503E probably benign Het
Lgi4 G A 7: 31,060,093 G25R probably benign Het
Olfr10 G A 11: 49,318,053 C169Y probably damaging Het
Olfr1461 T A 19: 13,165,387 Y124* probably null Het
Pcdh20 A G 14: 88,467,612 S751P probably damaging Het
Pcnx4 A G 12: 72,567,236 T652A probably benign Het
Pom121l2 T G 13: 21,984,168 F870V probably damaging Het
Prob1 T C 18: 35,654,721 D160G possibly damaging Het
Spa17 T C 9: 37,603,393 K133E probably damaging Het
Strbp T A 2: 37,640,873 D123V possibly damaging Het
Tnxb A G 17: 34,717,206 T3586A possibly damaging Het
Zfp518a T A 19: 40,912,315 H229Q probably damaging Het
Other mutations in Frs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0310:Frs3 UTSW 17 47703822 missense probably benign
R0638:Frs3 UTSW 17 47701656 missense probably benign 0.00
R1519:Frs3 UTSW 17 47702978 missense probably benign
R1668:Frs3 UTSW 17 47703222 missense possibly damaging 0.94
R2151:Frs3 UTSW 17 47703062 missense probably benign
R2517:Frs3 UTSW 17 47703072 missense probably benign 0.10
R3548:Frs3 UTSW 17 47703636 missense probably damaging 1.00
R3789:Frs3 UTSW 17 47699696 critical splice donor site probably null
R3890:Frs3 UTSW 17 47703435 missense probably damaging 0.99
R4981:Frs3 UTSW 17 47689262 unclassified probably null
R4996:Frs3 UTSW 17 47701710 missense probably damaging 1.00
R5479:Frs3 UTSW 17 47701710 missense probably damaging 1.00
R5944:Frs3 UTSW 17 47692308 intron probably benign
R5990:Frs3 UTSW 17 47701677 missense possibly damaging 0.81
R6102:Frs3 UTSW 17 47702671 missense probably damaging 1.00
R6151:Frs3 UTSW 17 47689088 start gained probably benign
R7219:Frs3 UTSW 17 47702695 missense probably damaging 1.00
R7359:Frs3 UTSW 17 47699525 missense probably damaging 0.98
R7404:Frs3 UTSW 17 47702726 critical splice donor site probably null
R8021:Frs3 UTSW 17 47703114 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGGCTTCCCTGATGGCGAG -3'
(R):5'- TTGAGAACCCTTCACAGTTTCCACC -3'

Sequencing Primer
(F):5'- GGAGGATGAAACCCCGCTAC -3'
(R):5'- GACACTCAGTGGCTGACATC -3'
Posted On2014-06-16