Incidental Mutation 'R0575:Dtwd2'
ID201512
Institutional Source Beutler Lab
Gene Symbol Dtwd2
Ensembl Gene ENSMUSG00000024505
Gene NameDTW domain containing 2
Synonyms1190002H09Rik, 8030470C17Rik
MMRRC Submission 038765-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R0575 (G1)
Quality Score56
Status Validated
Chromosome18
Chromosomal Location49696145-49755601 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 49698472 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 156 (C156F)
Ref Sequence ENSEMBL: ENSMUSP00000128219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025383] [ENSMUST00000163590]
Predicted Effect probably damaging
Transcript: ENSMUST00000025383
AA Change: C252F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025383
Gene: ENSMUSG00000024505
AA Change: C252F

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
low complexity region 32 45 N/A INTRINSIC
DTW 65 260 4.42e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139852
Predicted Effect probably damaging
Transcript: ENSMUST00000163590
AA Change: C156F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128219
Gene: ENSMUSG00000024505
AA Change: C156F

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
low complexity region 32 45 N/A INTRINSIC
DTW 65 164 3.12e-4 SMART
Meta Mutation Damage Score 0.9192 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,591,252 S264N possibly damaging Het
Acsm1 G A 7: 119,659,201 probably null Het
Adsl C T 15: 80,963,685 A93V probably damaging Het
Agbl5 A T 5: 30,894,454 S539C probably damaging Het
Aggf1 T A 13: 95,368,397 T285S probably benign Het
Anapc11 A G 11: 120,599,366 D36G probably benign Het
Ankrd44 G A 1: 54,762,310 A286V probably damaging Het
Atf7ip2 G T 16: 10,237,211 G281C probably damaging Het
Birc6 A G 17: 74,689,237 K4475E probably damaging Het
Ccbe1 T A 18: 66,093,995 probably benign Het
Cyp26b1 A G 6: 84,575,306 probably benign Het
Dcun1d1 T C 3: 35,897,785 probably benign Het
Efcab6 T G 15: 83,967,700 I326L probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
F5 C A 1: 164,176,244 Q203K probably damaging Het
Frs3 A G 17: 47,703,723 H447R possibly damaging Het
Gmds T G 13: 31,940,583 Q264P probably damaging Het
Golgb1 T A 16: 36,918,809 D2503E probably benign Het
Lgi4 G A 7: 31,060,093 G25R probably benign Het
Olfr10 G A 11: 49,318,053 C169Y probably damaging Het
Olfr1461 T A 19: 13,165,387 Y124* probably null Het
Pcdh20 A G 14: 88,467,612 S751P probably damaging Het
Pcnx4 A G 12: 72,567,236 T652A probably benign Het
Pom121l2 T G 13: 21,984,168 F870V probably damaging Het
Prob1 T C 18: 35,654,721 D160G possibly damaging Het
Spa17 T C 9: 37,603,393 K133E probably damaging Het
Strbp T A 2: 37,640,873 D123V possibly damaging Het
Tnxb A G 17: 34,717,206 T3586A possibly damaging Het
Zfp518a T A 19: 40,912,315 H229Q probably damaging Het
Other mutations in Dtwd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Dtwd2 APN 18 49723709 nonsense probably null
IGL00858:Dtwd2 APN 18 49728385 missense probably damaging 1.00
R0691:Dtwd2 UTSW 18 49728357 splice site probably benign
R2336:Dtwd2 UTSW 18 49700253 splice site probably benign
R4110:Dtwd2 UTSW 18 49698306 utr 3 prime probably benign
R4543:Dtwd2 UTSW 18 49724108 splice site probably null
R4920:Dtwd2 UTSW 18 49698440 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GTCAGCCAGTGACAGGTAAACTAGC -3'
(R):5'- GCCAACTAATTTGATGTGCCCATCTTC -3'

Sequencing Primer
(F):5'- CACCACAGGGACAGACGTG -3'
(R):5'- GTCACATAAGTGTCTGTATTTGAAAG -3'
Posted On2014-06-16