Incidental Mutation 'R0628:Copa'
ID201516
Institutional Source Beutler Lab
Gene Symbol Copa
Ensembl Gene ENSMUSG00000026553
Gene Namecoatomer protein complex subunit alpha
Synonymsxenin
MMRRC Submission 038817-MU
Accession Numbers

Genbank: NM_009938; MGI: 1334462

Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R0628 (G1)
Quality Score78
Status Validated
Chromosome1
Chromosomal Location172082529-172122330 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 172091025 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027833] [ENSMUST00000124289] [ENSMUST00000135192]
Predicted Effect probably benign
Transcript: ENSMUST00000027833
SMART Domains Protein: ENSMUSP00000027833
Gene: ENSMUSG00000026553

DomainStartEndE-ValueType
WD40 2 37 2.86e0 SMART
WD40 40 79 1.11e-6 SMART
WD40 82 121 4.76e-6 SMART
WD40 124 163 2.24e-11 SMART
WD40 194 233 2.98e-7 SMART
WD40 238 277 8.42e-7 SMART
WD40 280 318 1.38e1 SMART
Pfam:Coatomer_WDAD 338 776 5.4e-144 PFAM
Pfam:COPI_C 824 1233 1.4e-190 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124289
SMART Domains Protein: ENSMUSP00000118899
Gene: ENSMUSG00000026553

DomainStartEndE-ValueType
Blast:WD40 1 37 2e-19 BLAST
PDB:4J8G|B 1 52 2e-23 PDB
SCOP:d1erja_ 1 52 1e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126634
Predicted Effect probably benign
Transcript: ENSMUST00000135192
SMART Domains Protein: ENSMUSP00000118179
Gene: ENSMUSG00000026553

DomainStartEndE-ValueType
WD40 2 37 2.86e0 SMART
WD40 40 79 1.11e-6 SMART
WD40 82 121 4.76e-6 SMART
WD40 124 163 2.24e-11 SMART
WD40 194 233 2.98e-7 SMART
WD40 238 277 8.42e-7 SMART
WD40 280 318 1.38e1 SMART
Pfam:Coatomer_WDAD 338 767 1.1e-148 PFAM
Pfam:COPI_C 815 1224 3.6e-216 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192810
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In eukaryotic cells, protein transport between the endoplasmic reticulum and Golgi compartments is mediated in part by non-clathrin-coated vesicular coat proteins (COPs). Seven coat proteins have been identified, and they represent subunits of a complex known as coatomer. The subunits are designated alpha-COP, beta-COP, beta-prime-COP, gamma-COP, delta-COP, epsilon-COP, and zeta-COP. The alpha-COP, encoded by COPA, shares high sequence similarity with RET1P, the alpha subunit of the coatomer complex in yeast. Also, the N-terminal 25 amino acids of alpha-COP encode the bioactive peptide, xenin, which stimulates exocrine pancreatic secretion and may act as a gastrointestinal hormone. Alternative splicing results in multiple splice forms encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(6) : Gene trapped(6)

 

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik T C 5: 109,678,576 probably null Het
Alpk2 A C 18: 65,307,296 V809G possibly damaging Het
Bank1 T A 3: 136,066,390 D493V probably damaging Het
Camk2d T C 3: 126,810,624 probably benign Het
Ccdc17 T A 4: 116,598,548 L292H probably damaging Het
Ccdc7b A G 8: 129,111,017 probably benign Het
Cd34 C A 1: 194,959,217 T317K probably damaging Het
Col6a5 C G 9: 105,912,450 probably null Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Coq7 T C 7: 118,529,644 D56G probably damaging Het
Dlg4 C T 11: 70,031,784 T201I probably damaging Het
Dnah7a T A 1: 53,497,105 D2593V probably benign Het
Ect2l T A 10: 18,143,040 E536V probably damaging Het
Emilin3 A G 2: 160,910,879 probably benign Het
Eml2 T C 7: 19,201,554 probably benign Het
Fam135b C T 15: 71,448,656 probably benign Het
Fam160b2 T C 14: 70,587,721 T392A possibly damaging Het
Gart C T 16: 91,633,902 R424H probably benign Het
Gm9745 T A 13: 8,940,922 probably benign Het
Gramd1a A G 7: 31,142,624 L80P probably damaging Het
Herc1 A G 9: 66,450,881 K2415E probably benign Het
Ica1 C T 6: 8,644,256 probably benign Het
Iyd A T 10: 3,547,127 M161L probably damaging Het
Kdm5a T C 6: 120,415,239 L974S probably damaging Het
Kif1a T C 1: 93,019,883 D1619G probably damaging Het
Lypd8 C T 11: 58,384,673 T78M probably damaging Het
March10 T A 11: 105,390,160 H433L probably benign Het
Mbp A G 18: 82,554,617 Y13C probably damaging Het
Mertk A T 2: 128,738,313 N229I probably damaging Het
Msrb2 T A 2: 19,393,280 D116E probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Otoa G A 7: 121,145,650 probably benign Het
Pclo A G 5: 14,669,538 T1230A unknown Het
Polrmt T C 10: 79,739,145 T851A possibly damaging Het
Prpf6 C T 2: 181,636,048 P401L probably damaging Het
Rasgrp4 A G 7: 29,140,210 probably benign Het
Rc3h2 A T 2: 37,382,052 probably benign Het
Reps1 A G 10: 18,121,093 T588A probably damaging Het
Rtel1 A C 2: 181,351,881 S782R probably benign Het
Sacm1l A G 9: 123,548,995 probably benign Het
Skint5 A T 4: 113,731,069 L728* probably null Het
Slc9b2 T A 3: 135,323,775 probably benign Het
Snapc3 A T 4: 83,450,160 H298L probably benign Het
Tex9 A T 9: 72,491,951 M1K probably null Het
Trappc13 C T 13: 104,154,916 probably benign Het
Ttc37 G C 13: 76,150,729 V1185L possibly damaging Het
Usp3 C T 9: 66,518,444 R467H probably benign Het
Vmn2r11 T A 5: 109,047,731 L576F possibly damaging Het
Wnk4 T C 11: 101,275,023 F792S probably benign Het
Zfp280d T C 9: 72,361,948 V764A probably benign Het
Zfp69 G A 4: 120,949,425 Q4* probably null Het
Zfp692 T G 11: 58,309,623 L206R probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Zic4 T A 9: 91,384,117 Y264* probably null Het
Zic4 T A 9: 91,384,119 M272K probably benign Het
Zscan4b A T 7: 10,901,463 N284K probably damaging Het
Other mutations in Copa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Copa APN 1 172110688 missense possibly damaging 0.87
IGL01360:Copa APN 1 172087588 unclassified probably null
IGL01434:Copa APN 1 172119561 missense probably benign 0.00
IGL01744:Copa APN 1 172113189 missense probably benign 0.01
IGL01837:Copa APN 1 172118852 missense probably benign 0.01
IGL01988:Copa APN 1 172118264 missense probably benign 0.09
IGL02059:Copa APN 1 172099753 missense probably damaging 0.96
IGL02123:Copa APN 1 172112128 missense probably damaging 1.00
IGL02731:Copa APN 1 172102218 missense possibly damaging 0.77
IGL03114:Copa APN 1 172119268 nonsense probably null
P0027:Copa UTSW 1 172111948 missense possibly damaging 0.87
PIT4434001:Copa UTSW 1 172106175 missense probably benign 0.00
R0233:Copa UTSW 1 172087667 critical splice donor site probably null
R0465:Copa UTSW 1 172118305 missense probably damaging 1.00
R0547:Copa UTSW 1 172121687 splice site probably benign
R0568:Copa UTSW 1 172112137 missense possibly damaging 0.91
R1328:Copa UTSW 1 172121691 splice site probably benign
R1494:Copa UTSW 1 172104127 missense probably benign 0.27
R1728:Copa UTSW 1 172111987 missense probably benign
R1758:Copa UTSW 1 172104144 missense probably damaging 1.00
R1784:Copa UTSW 1 172111987 missense probably benign
R1942:Copa UTSW 1 172111888 missense probably damaging 1.00
R2054:Copa UTSW 1 172118957 nonsense probably null
R2299:Copa UTSW 1 172121725 missense probably benign 0.10
R2518:Copa UTSW 1 172119901 missense probably benign
R2680:Copa UTSW 1 172121404 nonsense probably null
R3080:Copa UTSW 1 172113149 missense probably damaging 1.00
R3160:Copa UTSW 1 172091233 missense probably damaging 1.00
R3161:Copa UTSW 1 172091233 missense probably damaging 1.00
R3162:Copa UTSW 1 172091233 missense probably damaging 1.00
R3162:Copa UTSW 1 172091233 missense probably damaging 1.00
R3973:Copa UTSW 1 172121245 missense probably benign 0.00
R3975:Copa UTSW 1 172121245 missense probably benign 0.00
R4031:Copa UTSW 1 172108375 missense probably damaging 1.00
R4155:Copa UTSW 1 172101425 missense probably damaging 1.00
R4227:Copa UTSW 1 172118115 intron probably benign
R4244:Copa UTSW 1 172110718 missense probably benign 0.00
R4254:Copa UTSW 1 172102244 missense probably damaging 1.00
R4291:Copa UTSW 1 172092397 intron probably benign
R4323:Copa UTSW 1 172119264 missense probably damaging 1.00
R4402:Copa UTSW 1 172102224 missense probably damaging 1.00
R4711:Copa UTSW 1 172119988 missense probably damaging 1.00
R4721:Copa UTSW 1 172104274 splice site probably benign
R4773:Copa UTSW 1 172105220 missense probably damaging 1.00
R4794:Copa UTSW 1 172119321 missense probably damaging 1.00
R4887:Copa UTSW 1 172092276 missense probably benign 0.39
R4953:Copa UTSW 1 172082886 unclassified probably benign
R5139:Copa UTSW 1 172121329 missense probably damaging 0.99
R5152:Copa UTSW 1 172118061 missense probably benign 0.34
R5297:Copa UTSW 1 172113108 missense probably damaging 1.00
R5586:Copa UTSW 1 172105222 missense probably damaging 1.00
R5698:Copa UTSW 1 172118944 nonsense probably null
R6283:Copa UTSW 1 172118848 missense possibly damaging 0.79
R6921:Copa UTSW 1 172111924 missense possibly damaging 0.63
R6934:Copa UTSW 1 172110686 missense possibly damaging 0.64
R7009:Copa UTSW 1 172091000 missense probably damaging 0.96
R7194:Copa UTSW 1 172119944 missense probably damaging 0.99
R7348:Copa UTSW 1 172102223 missense possibly damaging 0.96
R7710:Copa UTSW 1 172109844 missense possibly damaging 0.50
R7745:Copa UTSW 1 172111942 missense probably damaging 1.00
R7893:Copa UTSW 1 172119565 nonsense probably null
R7976:Copa UTSW 1 172119565 nonsense probably null
T0722:Copa UTSW 1 172111948 missense possibly damaging 0.87
Z1177:Copa UTSW 1 172106123 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGTAAACCTTTCAGGAGCCCAAGAC -3'
(R):5'- AATCAATCGGCAGACATGGCCC -3'

Sequencing Primer
(F):5'- AGACATCTACATCGGCTTTTGTTG -3'
(R):5'- CCCGAATGGTCTGATCATCTGAG -3'
Posted On2014-06-16