Incidental Mutation 'R0676:Cpb1'
ID201522
Institutional Source Beutler Lab
Gene Symbol Cpb1
Ensembl Gene ENSMUSG00000011463
Gene Namecarboxypeptidase B1 (tissue)
Synonyms1810063F02Rik, 0910001A18Rik, 2210008M23Rik
MMRRC Submission 038861-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0676 (G1)
Quality Score57
Status Validated
Chromosome3
Chromosomal Location20248264-20275733 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 20266533 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000011607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011607]
Predicted Effect probably null
Transcript: ENSMUST00000011607
SMART Domains Protein: ENSMUSP00000011607
Gene: ENSMUSG00000011463

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:Propep_M14 26 102 2.4e-19 PFAM
Zn_pept 117 398 2.08e-147 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137855
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Three different procarboxypeptidases A and two different procarboxypeptidases B have been isolated. The B1 and B2 forms differ from each other mainly in isoelectric point. Carboxypeptidase B1 is a highly tissue-specific protein and is a useful serum marker for acute pancreatitis and dysfunction of pancreatic transplants. It is not elevated in pancreatic carcinoma. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,964,657 probably benign Het
Arhgef25 A G 10: 127,184,010 probably null Het
B3galnt2 T C 13: 13,995,793 S243P probably benign Het
Col11a2 A G 17: 34,057,275 N799D probably damaging Het
Crot A C 5: 8,993,622 probably benign Het
Ctnna3 A C 10: 64,409,261 H451P probably benign Het
Cts6 C T 13: 61,197,484 probably benign Het
Dock2 T C 11: 34,695,236 T540A probably damaging Het
Dysf C A 6: 84,113,336 F956L probably benign Het
Gabrg3 A T 7: 56,724,421 Y466N probably damaging Het
Gm10845 T A 14: 79,863,204 noncoding transcript Het
H2-M5 A G 17: 36,989,142 F47L possibly damaging Het
Hist1h4i T C 13: 22,041,106 probably null Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Immt A G 6: 71,851,844 S128G probably benign Het
Klb A T 5: 65,379,055 D576V probably damaging Het
Lpin1 A T 12: 16,540,979 N817K possibly damaging Het
Lrrk1 C T 7: 66,294,981 R627H probably damaging Het
Luzp1 A G 4: 136,542,685 K740E probably damaging Het
Mapk9 T C 11: 49,883,156 *382Q probably null Het
Mn1 A G 5: 111,421,034 S957G possibly damaging Het
Mrgprb8 A T 7: 48,388,664 M28L probably benign Het
Myo1a A G 10: 127,719,880 I913V probably benign Het
Nolc1 T A 19: 46,080,089 probably benign Het
Pde4dip A C 3: 97,717,097 probably benign Het
Rbpj C T 5: 53,646,048 probably benign Het
Ric1 T C 19: 29,577,647 I387T probably benign Het
Ruvbl1 A G 6: 88,473,200 R58G probably damaging Het
Scarb1 C A 5: 125,297,214 probably benign Het
Sh3tc1 A T 5: 35,719,114 probably benign Het
Slc22a23 G A 13: 34,195,479 T435I probably damaging Het
Slc22a26 A T 19: 7,796,144 probably benign Het
Taf6l T C 19: 8,773,369 I114V probably benign Het
Tbc1d8b A G X: 139,712,276 S284G possibly damaging Het
Tmem131l C T 3: 83,934,815 probably benign Het
Vmn2r115 C T 17: 23,346,264 S375F probably benign Het
Other mutations in Cpb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Cpb1 APN 3 20252029 missense probably benign 0.00
IGL01061:Cpb1 APN 3 20266516 missense probably benign 0.06
IGL01376:Cpb1 APN 3 20270324 missense probably benign 0.00
IGL01409:Cpb1 APN 3 20249805 missense possibly damaging 0.51
IGL01505:Cpb1 APN 3 20266246 missense probably damaging 1.00
IGL01599:Cpb1 APN 3 20251954 critical splice donor site probably null
IGL01672:Cpb1 APN 3 20275421 missense probably null 0.34
IGL02421:Cpb1 APN 3 20251984 missense probably damaging 1.00
IGL02685:Cpb1 APN 3 20265356 missense probably damaging 1.00
IGL02825:Cpb1 APN 3 20249725 missense probably damaging 1.00
IGL02929:Cpb1 APN 3 20275466 missense probably benign 0.00
IGL03229:Cpb1 APN 3 20249837 nonsense probably null
R0106:Cpb1 UTSW 3 20266533 splice site probably null
R0106:Cpb1 UTSW 3 20266533 splice site probably null
R0485:Cpb1 UTSW 3 20275628 missense unknown
R0609:Cpb1 UTSW 3 20262474 missense probably damaging 1.00
R0622:Cpb1 UTSW 3 20249818 missense probably damaging 1.00
R0829:Cpb1 UTSW 3 20251943 splice site probably benign
R0981:Cpb1 UTSW 3 20275490 missense probably benign 0.29
R1496:Cpb1 UTSW 3 20263532 missense probably damaging 0.99
R1535:Cpb1 UTSW 3 20266287 missense probably benign 0.19
R1607:Cpb1 UTSW 3 20263782 missense probably benign 0.03
R1707:Cpb1 UTSW 3 20275491 missense probably damaging 0.99
R1753:Cpb1 UTSW 3 20266241 missense possibly damaging 0.67
R1866:Cpb1 UTSW 3 20263756 missense probably benign 0.00
R2177:Cpb1 UTSW 3 20266447 missense probably benign 0.41
R2234:Cpb1 UTSW 3 20275465 missense probably benign 0.04
R3110:Cpb1 UTSW 3 20265357 missense probably damaging 1.00
R3112:Cpb1 UTSW 3 20265357 missense probably damaging 1.00
R4353:Cpb1 UTSW 3 20262544 missense probably benign 0.07
R4405:Cpb1 UTSW 3 20263569 missense probably benign 0.00
R4485:Cpb1 UTSW 3 20249701 missense probably benign 0.00
R4734:Cpb1 UTSW 3 20263712 missense probably benign 0.43
R4984:Cpb1 UTSW 3 20270352 frame shift probably null
R5807:Cpb1 UTSW 3 20263742 missense probably damaging 0.98
R6377:Cpb1 UTSW 3 20275584 critical splice donor site probably null
R6441:Cpb1 UTSW 3 20249814 missense probably damaging 1.00
R7175:Cpb1 UTSW 3 20263763 missense probably benign 0.00
R7488:Cpb1 UTSW 3 20270324 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GTGACATTGTTGGTTAAACTCCCATGC -3'
(R):5'- GGAAGATTCCATCTTACTCATGCCCC -3'

Sequencing Primer
(F):5'- TGCCAGCAAAATGTATCAGAATCAG -3'
(R):5'- GCCTCACTTTTTGTGATTGATACCAG -3'
Posted On2014-06-19