Incidental Mutation 'R0676:Hist1h4i'
ID201534
Institutional Source Beutler Lab
Gene Symbol Hist1h4i
Ensembl Gene ENSMUSG00000060639
Gene Namehistone cluster 1, H4i
Synonyms
MMRRC Submission 038861-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.687) question?
Stock #R0676 (G1)
Quality Score42
Status Validated
Chromosome13
Chromosomal Location22040636-22041362 bp(-) (GRCm38)
Type of Mutationunclassified (4761 bp from exon)
DNA Base Change (assembly) T to C at 22041106 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091741] [ENSMUST00000102977] [ENSMUST00000110452] [ENSMUST00000110455]
Predicted Effect probably benign
Transcript: ENSMUST00000091741
SMART Domains Protein: ENSMUSP00000089335
Gene: ENSMUSG00000069301

DomainStartEndE-ValueType
H2A 3 123 8.07e-81 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102977
AA Change: Y73C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100042
Gene: ENSMUSG00000060639
AA Change: Y73C

DomainStartEndE-ValueType
H4 16 90 2.59e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110452
SMART Domains Protein: ENSMUSP00000106082
Gene: ENSMUSG00000069300

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 4.64e-72 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110455
SMART Domains Protein: ENSMUSP00000106085
Gene: ENSMUSG00000062727

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 4.64e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198508
Meta Mutation Damage Score 0.9569 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H4 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,964,657 probably benign Het
Arhgef25 A G 10: 127,184,010 probably null Het
B3galnt2 T C 13: 13,995,793 S243P probably benign Het
Col11a2 A G 17: 34,057,275 N799D probably damaging Het
Cpb1 T C 3: 20,266,533 probably null Het
Crot A C 5: 8,993,622 probably benign Het
Ctnna3 A C 10: 64,409,261 H451P probably benign Het
Cts6 C T 13: 61,197,484 probably benign Het
Dock2 T C 11: 34,695,236 T540A probably damaging Het
Dysf C A 6: 84,113,336 F956L probably benign Het
Gabrg3 A T 7: 56,724,421 Y466N probably damaging Het
Gm10845 T A 14: 79,863,204 noncoding transcript Het
H2-M5 A G 17: 36,989,142 F47L possibly damaging Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Immt A G 6: 71,851,844 S128G probably benign Het
Klb A T 5: 65,379,055 D576V probably damaging Het
Lpin1 A T 12: 16,540,979 N817K possibly damaging Het
Lrrk1 C T 7: 66,294,981 R627H probably damaging Het
Luzp1 A G 4: 136,542,685 K740E probably damaging Het
Mapk9 T C 11: 49,883,156 *382Q probably null Het
Mn1 A G 5: 111,421,034 S957G possibly damaging Het
Mrgprb8 A T 7: 48,388,664 M28L probably benign Het
Myo1a A G 10: 127,719,880 I913V probably benign Het
Nolc1 T A 19: 46,080,089 probably benign Het
Pde4dip A C 3: 97,717,097 probably benign Het
Rbpj C T 5: 53,646,048 probably benign Het
Ric1 T C 19: 29,577,647 I387T probably benign Het
Ruvbl1 A G 6: 88,473,200 R58G probably damaging Het
Scarb1 C A 5: 125,297,214 probably benign Het
Sh3tc1 A T 5: 35,719,114 probably benign Het
Slc22a23 G A 13: 34,195,479 T435I probably damaging Het
Slc22a26 A T 19: 7,796,144 probably benign Het
Taf6l T C 19: 8,773,369 I114V probably benign Het
Tbc1d8b A G X: 139,712,276 S284G possibly damaging Het
Tmem131l C T 3: 83,934,815 probably benign Het
Vmn2r115 C T 17: 23,346,264 S375F probably benign Het
Other mutations in Hist1h4i
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0632:Hist1h4i UTSW 13 22041027 nonsense probably null
R4955:Hist1h4i UTSW 13 22041185 missense probably damaging 1.00
R6174:Hist1h4i UTSW 13 22041077 missense probably benign 0.41
R7556:Hist1h4i UTSW 13 22041244 missense probably damaging 1.00
Z1176:Hist1h4i UTSW 13 22041214 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCCCAAGCAGAAGGCTCTATTG -3'
(R):5'- TCCGGTCCGCAAGTTCCCTATAAG -3'

Sequencing Primer
(F):5'- cgggaagcaaaggcagac -3'
(R):5'- GCTTCGTCTTAGAGCAGTACAATC -3'
Posted On2014-06-19