Incidental Mutation 'Y5404:Rpf1'
ID201542
Institutional Source Beutler Lab
Gene Symbol Rpf1
Ensembl Gene ENSMUSG00000028187
Gene Nameribosome production factor 1 homolog
SynonymsBxdc5, 2210420E24Rik, 2310066N05Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #Y5404 ()
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location146505956-146521429 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146512836 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 148 (T148A)
Ref Sequence ENSEMBL: ENSMUSP00000143279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029838] [ENSMUST00000199079]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029838
AA Change: T148A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029838
Gene: ENSMUSG00000028187
AA Change: T148A

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
low complexity region 71 92 N/A INTRINSIC
Brix 145 319 4.82e-54 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196909
Predicted Effect probably damaging
Transcript: ENSMUST00000199079
AA Change: T148A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143279
Gene: ENSMUSG00000028187
AA Change: T148A

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
low complexity region 71 92 N/A INTRINSIC
Pfam:Brix 146 211 4.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200583
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.5%
  • 10x: 94.0%
  • 20x: 88.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 4 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bbs1 T C 19: 4,900,607 M203V possibly damaging Het
Drc7 GGATGATGATGATGATGATG GGATGATGATGATGATG 8: 95,068,150 probably benign Het
Gm4978 T G 9: 69,450,702 probably benign Het
Syt4 A G 18: 31,443,791 F170S probably damaging Het
Other mutations in Rpf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Rpf1 APN 3 146512247 missense probably benign 0.10
IGL01371:Rpf1 APN 3 146507547 missense probably damaging 1.00
IGL01729:Rpf1 APN 3 146507149 missense probably damaging 1.00
IGL02122:Rpf1 APN 3 146521267 missense probably benign
R0196:Rpf1 UTSW 3 146508149 missense possibly damaging 0.86
R1664:Rpf1 UTSW 3 146512148 missense probably benign 0.01
R2019:Rpf1 UTSW 3 146521221 missense probably damaging 1.00
R3151:Rpf1 UTSW 3 146507635 missense probably damaging 1.00
R4989:Rpf1 UTSW 3 146506538 missense probably damaging 1.00
R5133:Rpf1 UTSW 3 146506538 missense probably damaging 1.00
R5134:Rpf1 UTSW 3 146506538 missense probably damaging 1.00
R5172:Rpf1 UTSW 3 146512295 missense possibly damaging 0.94
R5383:Rpf1 UTSW 3 146519391 missense possibly damaging 0.92
R5525:Rpf1 UTSW 3 146517804 splice site silent
R5927:Rpf1 UTSW 3 146519463 splice site probably null
R5947:Rpf1 UTSW 3 146506544 missense probably damaging 1.00
R7070:Rpf1 UTSW 3 146512184 missense probably damaging 1.00
R7311:Rpf1 UTSW 3 146507163 missense probably benign 0.42
R8345:Rpf1 UTSW 3 146507676 missense probably benign 0.17
Y5405:Rpf1 UTSW 3 146512836 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCTGAAGAATTATGCTCAGTAAGTC -3'
(R):5'- TTGACACTGGCCGTTCACAC -3'

Sequencing Primer
(F):5'- CAGTAAGTCTGTTAATCCCCATCAG -3'
(R):5'- CGTTCACACTTGTGCAGAAG -3'
Posted On2014-06-23