Mutagenetix > Incidental Mutations

Incidental Mutation 'Y5404:Rpf1'

201542

Institutional Source

Beutler Lab

Gene Symbol

Rpf1

Ensembl Gene

ENSMUSG00000028187

Gene Name

ribosome production factor 1 homolog

Synonyms

Bxdc5, 2210420E24Rik, 2310066N05Rik

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.947) question?

Stock #

Y5404 ()

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

146505956-146521429 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 146512836 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 148 (T148A)

Ref Sequence

ENSEMBL: ENSMUSP00000143279 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029838] [ENSMUST00000199079]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029838
AA Change: T148A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000029838
Gene: ENSMUSG00000028187
AA Change: T148A

Domain	Start	End	E-Value	Type
low complexity region	10	31	N/A	INTRINSIC
low complexity region	71	92	N/A	INTRINSIC
Brix	145	319	4.82e-54	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196909

Predicted Effect

probably damaging
Transcript: ENSMUST00000199079
AA Change: T148A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143279
Gene: ENSMUSG00000028187
AA Change: T148A

Domain	Start	End	E-Value	Type
low complexity region	10	31	N/A	INTRINSIC
low complexity region	71	92	N/A	INTRINSIC
Pfam:Brix	146	211	4.7e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000199174

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200583

Coding Region Coverage

1x: 97.3%
3x: 96.5%
10x: 94.0%
20x: 88.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 4 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bbs1	T	C	19: 4,900,607	M203V	possibly damaging	Het
Drc7	GGATGATGATGATGATGATG	GGATGATGATGATGATG	8: 95,068,150		probably benign	Het
Gm4978	T	G	9: 69,450,702		probably benign	Het
Syt4	A	G	18: 31,443,791	F170S	probably damaging	Het

Other mutations in Rpf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Rpf1	APN	3	146512247	missense	probably benign	0.10
IGL01371:Rpf1	APN	3	146507547	missense	probably damaging	1.00
IGL01729:Rpf1	APN	3	146507149	missense	probably damaging	1.00
IGL02122:Rpf1	APN	3	146521267	missense	probably benign
R0196:Rpf1	UTSW	3	146508149	missense	possibly damaging	0.86
R1664:Rpf1	UTSW	3	146512148	missense	probably benign	0.01
R2019:Rpf1	UTSW	3	146521221	missense	probably damaging	1.00
R3151:Rpf1	UTSW	3	146507635	missense	probably damaging	1.00
R4989:Rpf1	UTSW	3	146506538	missense	probably damaging	1.00
R5133:Rpf1	UTSW	3	146506538	missense	probably damaging	1.00
R5134:Rpf1	UTSW	3	146506538	missense	probably damaging	1.00
R5172:Rpf1	UTSW	3	146512295	missense	possibly damaging	0.94
R5383:Rpf1	UTSW	3	146519391	missense	possibly damaging	0.92
R5525:Rpf1	UTSW	3	146517804	splice site	silent
R5927:Rpf1	UTSW	3	146519463	splice site	probably null
R5947:Rpf1	UTSW	3	146506544	missense	probably damaging	1.00
R7070:Rpf1	UTSW	3	146512184	missense	probably damaging	1.00
R7311:Rpf1	UTSW	3	146507163	missense	probably benign	0.42
R8345:Rpf1	UTSW	3	146507676	missense	probably benign	0.17
Y5405:Rpf1	UTSW	3	146512836	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCCTGAAGAATTATGCTCAGTAAGTC -3'
(R):5'- TTGACACTGGCCGTTCACAC -3'

Sequencing Primer
(F):5'- CAGTAAGTCTGTTAATCCCCATCAG -3'
(R):5'- CGTTCACACTTGTGCAGAAG -3'

Posted On

2014-06-23