Mutagenetix > Incidental Mutation

Incidental Mutation 'Y5404:Syt4'

201545

Institutional Source

Beutler Lab

Gene Symbol

Syt4

Ensembl Gene

ENSMUSG00000024261

Gene Name

synaptotagmin IV

Synonyms

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

Y5404 ()

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31570861-31580459 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 31576844 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 170 (F170S)

Ref Sequence

ENSEMBL: ENSMUSP00000025110 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025110]

AlphaFold

P40749

Predicted Effect

probably damaging
Transcript: ENSMUST00000025110
AA Change: F170S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025110
Gene: ENSMUSG00000024261
AA Change: F170S

Domain	Start	End	E-Value	Type
transmembrane domain	15	37	N/A	INTRINSIC
low complexity region	68	79	N/A	INTRINSIC
low complexity region	137	150	N/A	INTRINSIC
C2	169	273	1.5e-19	SMART
C2	303	417	3.5e-20	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181067

Coding Region Coverage

1x: 97.3%
3x: 96.5%
10x: 94.0%
20x: 88.5%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene belongs to the synaptotagmin family. Members of this family are multi-domained, integral membrane proteins of synaptic vesicles, and are thought to serve as Ca2+ sensors in the process of vesicular trafficking and exocytosis. This gene is primarily expressed in the nervous tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impairments in motor coordination, contextual fear conditioning, and social transmission of food preference. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 4 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bbs1	T	C	19: 4,950,635 (GRCm39)	M203V	possibly damaging	Het
Drc7	GGATGATGATGATGATGATG	GGATGATGATGATGATG	8: 95,794,778 (GRCm39)		probably benign	Het
Gm4978	T	G	9: 69,357,984 (GRCm39)		probably benign	Het
Rpf1	T	C	3: 146,218,591 (GRCm39)	T148A	probably damaging	Het

Other mutations in Syt4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00971:Syt4	APN	18	31,580,227 (GRCm39)	utr 5 prime	probably benign
IGL01476:Syt4	APN	18	31,574,696 (GRCm39)	missense	probably damaging	1.00
IGL02412:Syt4	APN	18	31,576,896 (GRCm39)	missense	probably benign	0.19
IGL02550:Syt4	APN	18	31,577,246 (GRCm39)	missense	probably damaging	1.00
IGL02996:Syt4	APN	18	31,577,199 (GRCm39)	missense	probably damaging	1.00
F6893:Syt4	UTSW	18	31,577,274 (GRCm39)	missense	possibly damaging	0.74
PIT4434001:Syt4	UTSW	18	31,573,384 (GRCm39)	missense	probably damaging	1.00
R0103:Syt4	UTSW	18	31,580,273 (GRCm39)	start gained	probably benign
R0526:Syt4	UTSW	18	31,576,799 (GRCm39)	missense	possibly damaging	0.95
R1122:Syt4	UTSW	18	31,573,255 (GRCm39)	missense	probably damaging	1.00
R1622:Syt4	UTSW	18	31,577,069 (GRCm39)	missense	probably damaging	1.00
R1786:Syt4	UTSW	18	31,576,496 (GRCm39)	splice site	probably benign
R1895:Syt4	UTSW	18	31,577,141 (GRCm39)	missense	probably damaging	1.00
R2114:Syt4	UTSW	18	31,573,520 (GRCm39)	missense	probably damaging	1.00
R2117:Syt4	UTSW	18	31,573,520 (GRCm39)	missense	probably damaging	1.00
R2655:Syt4	UTSW	18	31,576,597 (GRCm39)	missense	probably benign	0.01
R3079:Syt4	UTSW	18	31,574,738 (GRCm39)	missense	probably benign	0.08
R3730:Syt4	UTSW	18	31,577,189 (GRCm39)	missense	probably damaging	0.96
R4870:Syt4	UTSW	18	31,580,409 (GRCm39)	start gained	probably benign
R7638:Syt4	UTSW	18	31,576,875 (GRCm39)	missense	probably benign	0.20
R7646:Syt4	UTSW	18	31,574,658 (GRCm39)	missense	possibly damaging	0.95
R7746:Syt4	UTSW	18	31,577,318 (GRCm39)	missense	probably benign	0.02
R7799:Syt4	UTSW	18	31,573,245 (GRCm39)	nonsense	probably null
R8174:Syt4	UTSW	18	31,577,230 (GRCm39)	missense	probably benign	0.00
R8199:Syt4	UTSW	18	31,577,268 (GRCm39)	missense	probably benign	0.30
R8428:Syt4	UTSW	18	31,577,072 (GRCm39)	missense	probably damaging	1.00
R8436:Syt4	UTSW	18	31,573,472 (GRCm39)	missense	possibly damaging	0.93
R8487:Syt4	UTSW	18	31,576,790 (GRCm39)	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- GCAAGGAGAGCTCTTGGATG -3'
(R):5'- GACCTCAATGGCAACTTCCC -3'

Sequencing Primer
(F):5'- TGTGGGGATAAGGGATTCCATAG -3'
(R):5'- TCAATGGCAACTTCCCCAAAG -3'

Posted On

2014-06-23