Incidental Mutation 'Y5406:Plod1'
ID 201554
Institutional Source Beutler Lab
Gene Symbol Plod1
Ensembl Gene ENSMUSG00000019055
Gene Name procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1
Synonyms 2410042F05Rik, LH1, lysyl hydroxylase 1
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # Y5406 ()
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 147994210-148021224 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 148015644 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 135 (P135L)
Ref Sequence ENSEMBL: ENSMUSP00000101337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019199] [ENSMUST00000105712]
AlphaFold Q9R0E2
Predicted Effect probably damaging
Transcript: ENSMUST00000019199
AA Change: P135L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019199
Gene: ENSMUSG00000019055
AA Change: P135L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
Blast:P4Hc 444 492 1e-8 BLAST
P4Hc 554 727 4.87e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105712
AA Change: P135L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101337
Gene: ENSMUSG00000019055
AA Change: P135L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132075
Coding Region Coverage
  • 1x: 97.2%
  • 3x: 96.4%
  • 10x: 93.6%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Lysyl hydroxylase is a membrane-bound homodimeric protein localized to the cisternae of the endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VI have deficiencies in lysyl hydroxylase activity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit hypotonia, reduced voluntary movement, abnormal aorta and skin collagen fibers, irregular vascular smooth muscle and premature death associated with thoracic cavity hemorrhage and aortic dissection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 6 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Col22a1 G A 15: 71,671,364 (GRCm39) P999S unknown Het
Kcnc1 G A 7: 46,076,803 (GRCm39) V202I probably benign Het
Lactb G T 9: 66,863,437 (GRCm39) Y392* probably null Het
Lrp1 A T 10: 127,390,152 (GRCm39) L3089H probably damaging Het
Orc6 A G 8: 86,034,302 (GRCm39) E175G probably damaging Het
Trhr A G 15: 44,061,037 (GRCm39) N186D probably benign Het
Other mutations in Plod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01144:Plod1 APN 4 148,017,211 (GRCm39) missense probably benign 0.12
IGL02312:Plod1 APN 4 148,010,614 (GRCm39) missense probably benign 0.09
IGL02588:Plod1 APN 4 147,997,747 (GRCm39) nonsense probably null
IGL02712:Plod1 APN 4 148,003,344 (GRCm39) missense possibly damaging 0.95
IGL02976:Plod1 APN 4 147,997,778 (GRCm39) missense probably damaging 0.99
IGL03244:Plod1 APN 4 148,007,580 (GRCm39) critical splice donor site probably null
R0393:Plod1 UTSW 4 148,003,298 (GRCm39) missense probably null 0.35
R1216:Plod1 UTSW 4 148,005,584 (GRCm39) missense probably damaging 0.98
R1897:Plod1 UTSW 4 148,010,657 (GRCm39) missense probably damaging 0.97
R3776:Plod1 UTSW 4 148,015,734 (GRCm39) missense possibly damaging 0.75
R3923:Plod1 UTSW 4 148,000,280 (GRCm39) missense possibly damaging 0.62
R4718:Plod1 UTSW 4 148,000,701 (GRCm39) intron probably benign
R4897:Plod1 UTSW 4 148,004,736 (GRCm39) missense probably benign
R5173:Plod1 UTSW 4 148,000,758 (GRCm39) intron probably benign
R5657:Plod1 UTSW 4 148,003,238 (GRCm39) missense possibly damaging 0.46
R6298:Plod1 UTSW 4 148,000,772 (GRCm39) intron probably benign
R6995:Plod1 UTSW 4 148,000,675 (GRCm39) intron probably benign
R7176:Plod1 UTSW 4 147,997,744 (GRCm39) missense probably benign 0.00
R7632:Plod1 UTSW 4 148,011,481 (GRCm39) missense probably damaging 1.00
R8059:Plod1 UTSW 4 148,012,941 (GRCm39) missense probably damaging 1.00
R8167:Plod1 UTSW 4 148,004,658 (GRCm39) missense probably damaging 1.00
R8804:Plod1 UTSW 4 147,997,778 (GRCm39) missense probably damaging 0.99
R8909:Plod1 UTSW 4 148,011,563 (GRCm39) nonsense probably null
R8986:Plod1 UTSW 4 147,997,734 (GRCm39) missense probably damaging 0.99
R9245:Plod1 UTSW 4 148,010,626 (GRCm39) missense possibly damaging 0.86
R9646:Plod1 UTSW 4 148,016,112 (GRCm39) missense probably benign 0.03
X0013:Plod1 UTSW 4 148,011,499 (GRCm39) missense possibly damaging 0.70
Y5408:Plod1 UTSW 4 148,015,644 (GRCm39) missense probably damaging 1.00
Z1176:Plod1 UTSW 4 148,007,657 (GRCm39) missense probably damaging 0.99
Z1177:Plod1 UTSW 4 148,016,178 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCAGGGGTGACTCACATTGTG -3'
(R):5'- CAGATCTGTCTCTCAGGTGGTG -3'

Sequencing Primer
(F):5'- TCACATTGTGAGGAGGACCC -3'
(R):5'- GTGTAGAATGTGAGGGGGTCCC -3'
Posted On 2014-06-23