Mutagenetix > Incidental Mutation

Incidental Mutation 'Y5406:Orc6'

201556

Institutional Source

Beutler Lab

Gene Symbol

Orc6

Ensembl Gene

ENSMUSG00000031697

Gene Name

origin recognition complex, subunit 6

Synonyms

6720420I10Rik, Orc6l

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

Y5406 ()

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86026261-86034907 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86034302 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 175 (E175G)

Ref Sequence

ENSEMBL: ENSMUSP00000126925 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034132] [ENSMUST00000170141] [ENSMUST00000210146] [ENSMUST00000211396] [ENSMUST00000211597]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000034132
AA Change: E251G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034132
Gene: ENSMUSG00000031697
AA Change: E251G

Domain	Start	End	E-Value	Type
Pfam:ORC6	6	108	1.5e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000170141
AA Change: E175G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126925
Gene: ENSMUSG00000031697
AA Change: E175G

Domain	Start	End	E-Value	Type
PDB:3M03\|C	18	111	2e-51	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000210146

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210458

Predicted Effect

probably benign
Transcript: ENSMUST00000211396

Predicted Effect

probably benign
Transcript: ENSMUST00000211597

Coding Region Coverage

1x: 97.2%
3x: 96.4%
10x: 93.6%
20x: 87.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunit protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. Gene silencing studies with small interfering RNA demonstrated that this protein plays an essential role in coordinating chromosome replication and segregation with cytokinesis. [provided by RefSeq, Oct 2010]

Allele List at MGI

Other mutations in this stock

Total: 6 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Col22a1	G	A	15: 71,671,364 (GRCm39)	P999S	unknown	Het
Kcnc1	G	A	7: 46,076,803 (GRCm39)	V202I	probably benign	Het
Lactb	G	T	9: 66,863,437 (GRCm39)	Y392*	probably null	Het
Lrp1	A	T	10: 127,390,152 (GRCm39)	L3089H	probably damaging	Het
Plod1	G	A	4: 148,015,644 (GRCm39)	P135L	probably damaging	Het
Trhr	A	G	15: 44,061,037 (GRCm39)	N186D	probably benign	Het

Other mutations in Orc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01893:Orc6	APN	8	86,034,272 (GRCm39)	missense	probably damaging	1.00
IGL02531:Orc6	APN	8	86,029,998 (GRCm39)	missense	probably damaging	1.00
IGL02713:Orc6	APN	8	86,034,215 (GRCm39)	missense	probably benign	0.00
IGL02997:Orc6	APN	8	86,032,837 (GRCm39)	unclassified	probably benign
R0685:Orc6	UTSW	8	86,027,783 (GRCm39)	missense	possibly damaging	0.93
R1667:Orc6	UTSW	8	86,031,914 (GRCm39)	missense	possibly damaging	0.94
R3619:Orc6	UTSW	8	86,026,623 (GRCm39)	critical splice donor site	probably null
R3810:Orc6	UTSW	8	86,026,613 (GRCm39)	missense	probably benign	0.05
R4707:Orc6	UTSW	8	86,029,579 (GRCm39)	missense	probably damaging	1.00
R4784:Orc6	UTSW	8	86,029,579 (GRCm39)	missense	probably damaging	1.00
R5743:Orc6	UTSW	8	86,029,585 (GRCm39)	missense	probably benign	0.02
R7062:Orc6	UTSW	8	86,029,537 (GRCm39)	missense	probably damaging	1.00
R7199:Orc6	UTSW	8	86,029,590 (GRCm39)	critical splice donor site	probably null
R7803:Orc6	UTSW	8	86,030,037 (GRCm39)	missense	possibly damaging	0.77
R7880:Orc6	UTSW	8	86,031,873 (GRCm39)	missense	probably benign	0.01
R9512:Orc6	UTSW	8	86,029,522 (GRCm39)	missense
R9521:Orc6	UTSW	8	86,026,615 (GRCm39)	missense	possibly damaging	0.95
R9620:Orc6	UTSW	8	86,026,430 (GRCm39)	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- GTGAGAGCTGCCATGTTACAC -3'
(R):5'- TCTAATGTCCATGTGAGGTGCC -3'

Sequencing Primer
(F):5'- ATGTTACACTGCACTCTAGGG -3'
(R):5'- TCCATGTGAGGTGCCCAGTG -3'

Posted On

2014-06-23