Incidental Mutation 'Y5406:Trhr'
ID 201559
Institutional Source Beutler Lab
Gene Symbol Trhr
Ensembl Gene ENSMUSG00000038760
Gene Name thyrotropin releasing hormone receptor
Synonyms TRH-R1
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # Y5406 ()
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 44059531-44099308 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 44061037 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 186 (N186D)
Ref Sequence ENSEMBL: ENSMUSP00000154650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038856] [ENSMUST00000110289] [ENSMUST00000226626] [ENSMUST00000227505]
AlphaFold P21761
Predicted Effect probably benign
Transcript: ENSMUST00000038856
AA Change: N186D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000036320
Gene: ENSMUSG00000038760
AA Change: N186D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 33 177 1.6e-7 PFAM
Pfam:7TM_GPCR_Srsx 36 335 4.8e-12 PFAM
Pfam:7tm_1 42 320 1.6e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110289
AA Change: N186D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000105918
Gene: ENSMUSG00000038760
AA Change: N186D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 33 175 1.9e-7 PFAM
Pfam:7TM_GPCR_Srsx 36 335 4.8e-12 PFAM
Pfam:7tm_1 42 320 1.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226626
AA Change: N186D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000227505
Meta Mutation Damage Score 0.0896 question?
Coding Region Coverage
  • 1x: 97.2%
  • 3x: 96.4%
  • 10x: 93.6%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor for thyrotropin-releasing hormone (TRH). Upon binding to TRH, this receptor activates the inositol phospholipid-calcium-protein kinase C transduction pathway. Mutations in this gene have been associated with generalized thyrotropin-releasing hormone resistance. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice are fertile and display decreased thyroxine, triiodothyronine, and prolactin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 6 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Col22a1 G A 15: 71,671,364 (GRCm39) P999S unknown Het
Kcnc1 G A 7: 46,076,803 (GRCm39) V202I probably benign Het
Lactb G T 9: 66,863,437 (GRCm39) Y392* probably null Het
Lrp1 A T 10: 127,390,152 (GRCm39) L3089H probably damaging Het
Orc6 A G 8: 86,034,302 (GRCm39) E175G probably damaging Het
Plod1 G A 4: 148,015,644 (GRCm39) P135L probably damaging Het
Other mutations in Trhr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Trhr APN 15 44,092,708 (GRCm39) missense probably damaging 1.00
IGL01800:Trhr APN 15 44,092,603 (GRCm39) missense possibly damaging 0.69
IGL01945:Trhr APN 15 44,060,540 (GRCm39) missense probably damaging 0.99
IGL02608:Trhr APN 15 44,061,074 (GRCm39) missense probably benign 0.08
IGL02825:Trhr APN 15 44,092,921 (GRCm39) missense possibly damaging 0.62
pushover UTSW 15 44,061,023 (GRCm39) missense probably damaging 1.00
P4717OSA:Trhr UTSW 15 44,060,831 (GRCm39) missense probably damaging 0.97
R0007:Trhr UTSW 15 44,092,547 (GRCm39) splice site probably benign
R0276:Trhr UTSW 15 44,060,482 (GRCm39) start codon destroyed probably null 0.74
R0620:Trhr UTSW 15 44,092,896 (GRCm39) missense probably benign 0.01
R1563:Trhr UTSW 15 44,060,497 (GRCm39) missense probably benign 0.05
R1728:Trhr UTSW 15 44,060,549 (GRCm39) missense probably damaging 1.00
R1729:Trhr UTSW 15 44,060,549 (GRCm39) missense probably damaging 1.00
R2144:Trhr UTSW 15 44,060,579 (GRCm39) missense probably benign 0.44
R2167:Trhr UTSW 15 44,092,638 (GRCm39) missense probably damaging 1.00
R3965:Trhr UTSW 15 44,061,095 (GRCm39) missense possibly damaging 0.70
R4246:Trhr UTSW 15 44,096,856 (GRCm39) critical splice acceptor site probably null
R4272:Trhr UTSW 15 44,060,620 (GRCm39) missense probably damaging 0.97
R4378:Trhr UTSW 15 44,061,023 (GRCm39) missense probably damaging 1.00
R4618:Trhr UTSW 15 44,061,037 (GRCm39) missense probably benign 0.00
R5093:Trhr UTSW 15 44,060,980 (GRCm39) missense probably damaging 0.96
R5388:Trhr UTSW 15 44,060,873 (GRCm39) missense possibly damaging 0.91
R5496:Trhr UTSW 15 44,060,932 (GRCm39) missense probably benign 0.00
R6341:Trhr UTSW 15 44,092,694 (GRCm39) nonsense probably null
R6463:Trhr UTSW 15 44,060,981 (GRCm39) missense probably benign 0.09
R6575:Trhr UTSW 15 44,092,602 (GRCm39) missense possibly damaging 0.83
R7483:Trhr UTSW 15 44,092,627 (GRCm39) missense probably damaging 1.00
R8780:Trhr UTSW 15 44,061,149 (GRCm39) missense possibly damaging 0.84
R8807:Trhr UTSW 15 44,061,212 (GRCm39) missense probably benign 0.00
R8897:Trhr UTSW 15 44,060,736 (GRCm39) missense probably benign 0.00
R9525:Trhr UTSW 15 44,060,873 (GRCm39) missense possibly damaging 0.91
R9614:Trhr UTSW 15 44,060,981 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GTACATAGCAATCTGTCACCCC -3'
(R):5'- TGCTTACCTGCTTCCTGGAAG -3'

Sequencing Primer
(F):5'- CATCAAAGCCCAGTTTCTCTG -3'
(R):5'- ACCTGCTTCCTGGAAGATACAGTG -3'
Posted On 2014-06-23