Mutagenetix > Incidental Mutation

Incidental Mutation 'Y5408:Mogat2'

201570

Institutional Source

Beutler Lab

Gene Symbol

Mogat2

Ensembl Gene

ENSMUSG00000052396

Gene Name

monoacylglycerol O-acyltransferase 2

Synonyms

DGAT2L5, Mgat2

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.104) question?

Stock #

Y5408 ()

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98868291-98887818 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 98872837 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 116 (G116R)

Ref Sequence

ENSEMBL: ENSMUSP00000064041 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064231]

AlphaFold

Q80W94

Predicted Effect

probably damaging
Transcript: ENSMUST00000064231
AA Change: G116R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064041
Gene: ENSMUSG00000052396
AA Change: G116R

Domain	Start	End	E-Value	Type
Pfam:DAGAT	39	334	9.1e-120	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132343

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208323

Coding Region Coverage

1x: 97.2%
3x: 96.6%
10x: 95.0%
20x: 91.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that catalyzes the synthesis of diacylglycerol from 2-monoacylglycerol and fatty acyl-CoA. The encoded protein is important in the uptake of dietary fat by the small intestine. This protein forms a complex with diacylglycerol O-acyltransferase 2 in the endoplasmic reticulum, and this complex catalyzes the synthesis of triacylglycerol. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit resistance to diet induced obesity, hyperinsulinemia, hyperlipidemia, and steatosis with decreased lipid absorption and increased oxygen consumption when fed a high fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 2 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Itih3	T	C	14: 30,643,902 (GRCm39)	N69S	probably damaging	Het
Plod1	G	A	4: 148,015,644 (GRCm39)	P135L	probably damaging	Het

Other mutations in Mogat2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01343:Mogat2	APN	7	98,881,775 (GRCm39)	missense	possibly damaging	0.60
IGL02052:Mogat2	APN	7	98,887,771 (GRCm39)	start codon destroyed	probably null	0.99
IGL02153:Mogat2	APN	7	98,872,761 (GRCm39)	missense	possibly damaging	0.94
R0227:Mogat2	UTSW	7	98,872,339 (GRCm39)	missense	probably benign	0.02
R0490:Mogat2	UTSW	7	98,872,351 (GRCm39)	missense	probably benign	0.11
R1331:Mogat2	UTSW	7	98,872,722 (GRCm39)	missense	possibly damaging	0.66
R1546:Mogat2	UTSW	7	98,881,766 (GRCm39)	missense	probably damaging	1.00
R2879:Mogat2	UTSW	7	98,871,573 (GRCm39)	missense	possibly damaging	0.46
R4954:Mogat2	UTSW	7	98,887,724 (GRCm39)	missense	possibly damaging	0.95
R5040:Mogat2	UTSW	7	98,887,724 (GRCm39)	missense	possibly damaging	0.95
R5184:Mogat2	UTSW	7	98,872,842 (GRCm39)	missense	possibly damaging	0.90
R5822:Mogat2	UTSW	7	98,869,112 (GRCm39)	missense	possibly damaging	0.82
R6056:Mogat2	UTSW	7	98,872,720 (GRCm39)	missense	possibly damaging	0.95
R6256:Mogat2	UTSW	7	98,869,102 (GRCm39)	missense	probably damaging	1.00
R6500:Mogat2	UTSW	7	98,871,553 (GRCm39)	missense	probably benign	0.04
R7358:Mogat2	UTSW	7	98,881,673 (GRCm39)	missense	possibly damaging	0.93
R7375:Mogat2	UTSW	7	98,872,905 (GRCm39)	missense	probably damaging	1.00
Z1177:Mogat2	UTSW	7	98,872,836 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGAGCTGTTGACAGTCC -3'
(R):5'- CCATCTCTGTGGAAGCATCC -3'

Sequencing Primer
(F):5'- AGTCCTCTGTCAGATCCCC -3'
(R):5'- GGAAGCATCCAGTATACTCAGG -3'

Posted On

2014-06-23