Mutagenetix > Incidental Mutation

Incidental Mutation 'R1789:Col5a2'

201574

Institutional Source

Beutler Lab

Gene Symbol

Col5a2

Ensembl Gene

ENSMUSG00000026042

Gene Name

collagen, type V, alpha 2

Synonyms

1110014L14Rik

MMRRC Submission

039820-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1789 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

45374321-45503282 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 45394776 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 759 (Q759R)

Ref Sequence

ENSEMBL: ENSMUSP00000083620 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086430]

AlphaFold

Q3U962

Predicted Effect

probably damaging
Transcript: ENSMUST00000086430
AA Change: Q759R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000083620
Gene: ENSMUSG00000026042
AA Change: Q759R

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
VWC	40	95	9.94e-23	SMART
Pfam:Collagen	123	186	1.5e-10	PFAM
Pfam:Collagen	207	272	2.9e-9	PFAM
low complexity region	319	347	N/A	INTRINSIC
internal_repeat_1	349	421	3.18e-18	PROSPERO
internal_repeat_2	385	422	1.34e-12	PROSPERO
internal_repeat_5	388	423	1.55e-7	PROSPERO
low complexity region	424	460	N/A	INTRINSIC
low complexity region	471	508	N/A	INTRINSIC
internal_repeat_6	509	535	5.68e-7	PROSPERO
internal_repeat_2	511	548	1.34e-12	PROSPERO
internal_repeat_3	520	549	1.16e-11	PROSPERO
internal_repeat_1	520	571	3.18e-18	PROSPERO
internal_repeat_4	546	574	4.91e-9	PROSPERO
low complexity region	595	611	N/A	INTRINSIC
internal_repeat_7	616	741	1.35e-6	PROSPERO
low complexity region	742	757	N/A	INTRINSIC
Pfam:Collagen	790	870	4.8e-8	PFAM
low complexity region	877	898	N/A	INTRINSIC
Pfam:Collagen	907	979	4.2e-8	PFAM
internal_repeat_4	993	1021	4.91e-9	PROSPERO
internal_repeat_3	994	1023	1.16e-11	PROSPERO
low complexity region	1024	1054	N/A	INTRINSIC
internal_repeat_6	1055	1078	5.68e-7	PROSPERO
low complexity region	1081	1096	N/A	INTRINSIC
Pfam:Collagen	1111	1171	9.7e-12	PFAM
Pfam:Collagen	1168	1230	1.4e-9	PFAM
COLFI	1263	1497	1.83e-164	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150143

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes the alpha-2 subunit of type V collagen, one of the low abundance fibrillar collagens that gets incorporated into growing fibrils with type I collagen. The encoded protein, in association with alpha-1 and/or alpha-3 subunits, forms homo- or heterotrimeric type V procollagen that undergoes proteolytic processing. Mice lacking the encoded protein die in utero. Transgenic mice that produce a structurally abnormal form of the encoded protein survive poorly and exhibit skin fragility, skeletal abnormalities and alterations in the collagen fiber organization. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality. Mutant animals exhibit reduced body weight, reduced bone growth rate, thin, fragile skin, variable degrees of lordosis and kyphosis, abnormal localization of hair follicles in the dermis, and thinned stroma of the cornea. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	G	A	16: 20,365,951	P986L	probably damaging	Het
Acad10	A	T	5: 121,631,393	Y667N	possibly damaging	Het
Ahi1	G	A	10: 20,963,115	G121D	probably benign	Het
Ampd1	T	A	3: 103,099,126	I690N	possibly damaging	Het
Amy1	C	A	3: 113,558,165	W425L	possibly damaging	Het
Arhgap27	A	T	11: 103,333,005	V823E	probably damaging	Het
Arhgef17	A	G	7: 100,929,870	S624P	probably damaging	Het
Arid5b	T	C	10: 68,186,067	H231R	probably damaging	Het
Aspscr1	C	A	11: 120,688,560	T78N	probably damaging	Het
Auts2	T	A	5: 131,472,450	T42S	probably damaging	Het
Ccdc171	A	G	4: 83,554,808	D158G	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap61	T	C	2: 145,939,993		probably null	Het
Chrna5	T	C	9: 55,004,651	V245A	possibly damaging	Het
Cntnap5c	G	A	17: 58,013,921	G163R	probably damaging	Het
Comp	A	G	8: 70,377,146	D340G	probably benign	Het
Cyfip1	T	A	7: 55,926,395	D1104E	probably damaging	Het
Dnah11	A	T	12: 118,038,780	S308T	probably damaging	Het
Dnah5	A	G	15: 28,270,426	H958R	probably benign	Het
Elp3	A	G	14: 65,547,919	Y478H	probably damaging	Het
Fat3	T	C	9: 16,376,985	Y414C	probably benign	Het
Fbxo10	C	A	4: 45,046,389	A574S	probably damaging	Het
Fsip2	G	T	2: 82,977,562	L1408F	probably benign	Het
Fubp3	T	C	2: 31,611,735	V425A	possibly damaging	Het
Gm7168	A	T	17: 13,949,584	R404S	probably benign	Het
Gm8773	A	T	5: 5,575,652	Q116L	possibly damaging	Het
Gpd1	T	G	15: 99,723,202	F299C	probably damaging	Het
Gpr137	C	T	19: 6,942,057		probably benign	Het
Grin3b	T	C	10: 79,973,408	S331P	probably benign	Het
Grk3	T	A	5: 112,941,718	I281F	probably damaging	Het
Hoxb7	T	A	11: 96,286,781	S18R	probably damaging	Het
Igf1r	C	T	7: 68,214,933	R1160*	probably null	Het
Itfg1	A	G	8: 85,725,512		probably null	Het
Itgb8	T	C	12: 119,202,455	I114V	probably benign	Het
Kcnk1	A	G	8: 126,025,384	E243G	possibly damaging	Het
Kif27	A	G	13: 58,344,008	L439P	probably damaging	Het
Kif2c	T	A	4: 117,167,361	Q279L	probably benign	Het
Kmt2d	A	T	15: 98,852,074		probably benign	Het
L3mbtl1	A	G	2: 162,974,502	T821A	probably benign	Het
Lrrc24	A	T	15: 76,722,578	M206K	probably benign	Het
Mamdc4	T	G	2: 25,567,622	K460Q	possibly damaging	Het
Maml2	C	G	9: 13,697,345	L30V	probably damaging	Het
Mc5r	C	G	18: 68,338,670		probably null	Het
Myo10	T	G	15: 25,726,525		probably null	Het
Myo1e	T	A	9: 70,338,784	L419Q	probably damaging	Het
Myo6	C	A	9: 80,300,572	H1115Q	probably damaging	Het
Myo7a	A	G	7: 98,107,095	V10A	probably damaging	Het
Myoz2	C	T	3: 123,026,127	R61H	probably damaging	Het
Ncdn	G	A	4: 126,752,003	R38C	probably damaging	Het
Nckap1	T	A	2: 80,520,556	T736S	probably benign	Het
Ncor2	G	A	5: 125,019,890	A2325V	probably damaging	Het
Nid2	T	A	14: 19,752,431	V140E	possibly damaging	Het
Nlrp9c	C	A	7: 26,380,490	D704Y	probably benign	Het
Notch3	T	A	17: 32,158,725	S126C	probably damaging	Het
Olfr1128	A	T	2: 87,544,983	L187H	probably damaging	Het
Olfr130	T	C	17: 38,067,948	I259T	probably damaging	Het
Olfr215	A	C	6: 116,582,697	F83C	probably damaging	Het
Olfr484	A	G	7: 108,124,915	F116S	probably benign	Het
Olfr804	T	C	10: 129,705,607	M243T	possibly damaging	Het
Olfr818	A	T	10: 129,945,582	L160*	probably null	Het
Pdzd7	A	G	19: 45,039,228	I269T	probably damaging	Het
Phf3	A	T	1: 30,806,206	D1299E	probably damaging	Het
Pitx2	T	A	3: 129,218,754	Y271N	probably damaging	Het
Polk	T	C	13: 96,496,632	E301G	probably damaging	Het
Prkdc	C	A	16: 15,739,524	N2230K	probably damaging	Het
Prlr	A	G	15: 10,322,536	E170G	probably benign	Het
Prss55	A	G	14: 64,075,730	I235T	probably damaging	Het
Psd3	T	C	8: 67,960,565	I724V	probably benign	Het
Rabep2	A	G	7: 126,438,799	T248A	possibly damaging	Het
Rbm26	T	A	14: 105,117,073	K949N	probably benign	Het
Rnf213	T	A	11: 119,440,221	D2085E	probably damaging	Het
Serpinb7	A	T	1: 107,450,273	H232L	possibly damaging	Het
Slu7	A	G	11: 43,445,242	Q484R	probably benign	Het
Smg1	A	G	7: 118,145,798	S3044P	possibly damaging	Het
Snrnp48	A	G	13: 38,221,360	D248G	possibly damaging	Het
Snrpc	C	A	17: 27,845,219	P66Q	unknown	Het
Snrpn	T	A	7: 59,983,459		probably benign	Het
Spag17	T	A	3: 99,939,356	S65R	possibly damaging	Het
Srsf6	C	A	2: 162,934,488		probably benign	Het
Stil	T	A	4: 115,041,782	M1203K	probably benign	Het
Syt17	T	C	7: 118,436,838	T106A	probably benign	Het
Tbx15	C	T	3: 99,352,246	Q478*	probably null	Het
Tg	A	T	15: 66,737,548	Q319L	probably benign	Het
Thada	A	G	17: 84,448,033	L243P	probably damaging	Het
Thada	G	T	17: 84,448,034	L243I	probably damaging	Het
Tnnt3	A	G	7: 142,512,364	R211G	probably damaging	Het
Togaram1	A	T	12: 65,002,635	Q1282L	possibly damaging	Het
Tpm3-rs7	T	G	14: 113,314,947	M91R	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Ttll7	T	G	3: 146,915,780	L378R	probably damaging	Het
Tyw1	T	G	5: 130,258,993	I22R	probably damaging	Het
Ubr3	T	C	2: 70,016,367	S1645P	possibly damaging	Het
Ubr4	T	C	4: 139,393,053	L263P	probably damaging	Het
Unc13c	T	C	9: 73,756,339	E1071G	possibly damaging	Het
Vmn2r44	G	T	7: 8,380,123	D157E	possibly damaging	Het
Vps16	C	T	2: 130,443,600	T821I	probably benign	Het
Washc4	T	C	10: 83,579,525	V793A	possibly damaging	Het
Wdr35	G	T	12: 8,977,435		probably null	Het
Zfp277	A	G	12: 40,364,085	F254L	probably benign	Het

Other mutations in Col5a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00567:Col5a2	APN	1	45392877	splice site	probably benign
IGL00978:Col5a2	APN	1	45376739	missense	probably benign	0.01
IGL01366:Col5a2	APN	1	45391888	missense	possibly damaging	0.46
IGL01487:Col5a2	APN	1	45376739	missense	probably benign	0.01
IGL01820:Col5a2	APN	1	45442825	missense	unknown
IGL01980:Col5a2	APN	1	45382233	splice site	probably benign
IGL02063:Col5a2	APN	1	45403419	critical splice donor site	probably null
IGL02134:Col5a2	APN	1	45391070	splice site	probably null
IGL02233:Col5a2	APN	1	45383587	splice site	probably null
IGL02489:Col5a2	APN	1	45392811	splice site	probably null
IGL02928:Col5a2	APN	1	45385020	missense	probably benign	0.41
IGL02931:Col5a2	APN	1	45385065	missense	probably damaging	1.00
IGL03328:Col5a2	APN	1	45376146	missense	possibly damaging	0.94
Beatnik	UTSW	1	45376778	missense	probably damaging	0.99
R0022:Col5a2	UTSW	1	45383683	nonsense	probably null
R0123:Col5a2	UTSW	1	45407035	missense	probably benign	0.28
R0180:Col5a2	UTSW	1	45411460	missense	probably damaging	1.00
R0225:Col5a2	UTSW	1	45407035	missense	probably benign	0.28
R0455:Col5a2	UTSW	1	45382102	splice site	probably benign
R0485:Col5a2	UTSW	1	45378482	missense	probably damaging	0.99
R0702:Col5a2	UTSW	1	45380131	missense	possibly damaging	0.54
R0745:Col5a2	UTSW	1	45407227	splice site	probably null
R1147:Col5a2	UTSW	1	45376771	missense	probably damaging	0.99
R1147:Col5a2	UTSW	1	45376771	missense	probably damaging	0.99
R1394:Col5a2	UTSW	1	45403419	critical splice donor site	probably null
R1494:Col5a2	UTSW	1	45502914	start codon destroyed	unknown
R1499:Col5a2	UTSW	1	45411466	missense	probably benign	0.00
R1733:Col5a2	UTSW	1	45407032	missense	possibly damaging	0.81
R1789:Col5a2	UTSW	1	45378305	critical splice donor site	probably null
R2114:Col5a2	UTSW	1	45376804	missense	probably damaging	0.98
R2915:Col5a2	UTSW	1	45413496	missense	probably damaging	1.00
R3861:Col5a2	UTSW	1	45380237	missense	probably damaging	0.98
R4015:Col5a2	UTSW	1	45403471	missense	probably benign	0.14
R4944:Col5a2	UTSW	1	45376695	missense	possibly damaging	0.75
R4982:Col5a2	UTSW	1	45389458	missense	possibly damaging	0.88
R5001:Col5a2	UTSW	1	45502898	missense	unknown
R5159:Col5a2	UTSW	1	45386831	critical splice donor site	probably null
R5197:Col5a2	UTSW	1	45393081	missense	probably benign	0.01
R5407:Col5a2	UTSW	1	45406280	missense	possibly damaging	0.54
R5502:Col5a2	UTSW	1	45380126	missense	probably damaging	1.00
R5575:Col5a2	UTSW	1	45378482	missense	probably damaging	0.99
R5622:Col5a2	UTSW	1	45427059	missense	probably benign
R5643:Col5a2	UTSW	1	45390042	missense	probably damaging	1.00
R5801:Col5a2	UTSW	1	45389481	critical splice acceptor site	probably null
R6075:Col5a2	UTSW	1	45502848	missense	unknown
R6211:Col5a2	UTSW	1	45376666	missense	probably damaging	0.99
R6407:Col5a2	UTSW	1	45376778	missense	probably damaging	0.99
R6494:Col5a2	UTSW	1	45378327	missense	probably damaging	0.99
R6582:Col5a2	UTSW	1	45390115	missense	possibly damaging	0.91
R6687:Col5a2	UTSW	1	45383604	missense	probably damaging	1.00
R7007:Col5a2	UTSW	1	45378449	missense	possibly damaging	0.53
R7062:Col5a2	UTSW	1	45417625	missense	probably benign	0.00
R7098:Col5a2	UTSW	1	45380067	missense	possibly damaging	0.48
R7243:Col5a2	UTSW	1	45376160	missense	probably benign	0.39
R7326:Col5a2	UTSW	1	45442867	missense	unknown
R7332:Col5a2	UTSW	1	45380165	missense	probably damaging	1.00
R7642:Col5a2	UTSW	1	45376088	missense	probably benign	0.01
R7890:Col5a2	UTSW	1	45404987	splice site	probably null
R8066:Col5a2	UTSW	1	45413468	critical splice donor site	probably null
R8375:Col5a2	UTSW	1	45442730	missense	unknown
R8444:Col5a2	UTSW	1	45396145	missense	probably benign	0.06
R8506:Col5a2	UTSW	1	45442784	missense	unknown
R8686:Col5a2	UTSW	1	45421987	missense	probably damaging	1.00
R8907:Col5a2	UTSW	1	45416946	missense	probably benign	0.27
R8932:Col5a2	UTSW	1	45380146	missense	probably benign	0.00
R8933:Col5a2	UTSW	1	45421963	missense
R9087:Col5a2	UTSW	1	45442658	missense	unknown
R9105:Col5a2	UTSW	1	45380206	missense	probably benign	0.00
R9282:Col5a2	UTSW	1	45438869	critical splice donor site	probably null
R9457:Col5a2	UTSW	1	45386844	missense	probably benign	0.00
R9457:Col5a2	UTSW	1	45392813	critical splice donor site	probably null
R9568:Col5a2	UTSW	1	45391838	missense	possibly damaging	0.89
R9727:Col5a2	UTSW	1	45376658	missense	possibly damaging	0.50
X0013:Col5a2	UTSW	1	45403258	critical splice donor site	probably null
Z1176:Col5a2	UTSW	1	45376146	missense	possibly damaging	0.94
Z1176:Col5a2	UTSW	1	45383680	missense	probably damaging	1.00
Z1176:Col5a2	UTSW	1	45396484	missense	probably benign	0.11
Z1177:Col5a2	UTSW	1	45402113	missense	probably damaging	1.00
Z1177:Col5a2	UTSW	1	45403473	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGGCTATGCATTTTCTCAAC -3'
(R):5'- GAGATCCCACTCAGACAGTTTC -3'

Sequencing Primer
(F):5'- GCTATGCATTTTCTCAACCAATAAAG -3'
(R):5'- GACAGTTTCCCTAATACACAATCTG -3'

Posted On

2014-06-23