Incidental Mutation 'R1789:Vps16'
ID 201583
Institutional Source Beutler Lab
Gene Symbol Vps16
Ensembl Gene ENSMUSG00000027411
Gene Name VSP16 CORVET/HOPS core subunit
Synonyms 1810074M16Rik
MMRRC Submission 039820-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.971) question?
Stock # R1789 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 130266259-130286189 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 130285520 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 821 (T821I)
Ref Sequence ENSEMBL: ENSMUSP00000028900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000028900
AA Change: T821I

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: T821I

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125098
Predicted Effect probably benign
Transcript: ENSMUST00000128994
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137084
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G A 16: 20,184,701 (GRCm39) P986L probably damaging Het
Acad10 A T 5: 121,769,456 (GRCm39) Y667N possibly damaging Het
Ahi1 G A 10: 20,839,014 (GRCm39) G121D probably benign Het
Ampd1 T A 3: 103,006,442 (GRCm39) I690N possibly damaging Het
Amy1 C A 3: 113,351,814 (GRCm39) W425L possibly damaging Het
Arhgap27 A T 11: 103,223,831 (GRCm39) V823E probably damaging Het
Arhgef17 A G 7: 100,579,077 (GRCm39) S624P probably damaging Het
Arid5b T C 10: 68,021,897 (GRCm39) H231R probably damaging Het
Aspscr1 C A 11: 120,579,386 (GRCm39) T78N probably damaging Het
Auts2 T A 5: 131,501,288 (GRCm39) T42S probably damaging Het
Ccdc171 A G 4: 83,473,045 (GRCm39) D158G probably damaging Het
Ces4a G A 8: 105,864,729 (GRCm39) G69S probably damaging Het
Cfap61 T C 2: 145,781,913 (GRCm39) probably null Het
Chrna5 T C 9: 54,911,935 (GRCm39) V245A possibly damaging Het
Cntnap5c G A 17: 58,320,916 (GRCm39) G163R probably damaging Het
Col5a2 A G 1: 45,417,465 (GRCm39) probably null Het
Col5a2 T C 1: 45,433,936 (GRCm39) Q759R probably damaging Het
Comp A G 8: 70,829,796 (GRCm39) D340G probably benign Het
Cyfip1 T A 7: 55,576,143 (GRCm39) D1104E probably damaging Het
Dnah11 A T 12: 118,002,515 (GRCm39) S308T probably damaging Het
Dnah5 A G 15: 28,270,572 (GRCm39) H958R probably benign Het
Elp3 A G 14: 65,785,368 (GRCm39) Y478H probably damaging Het
Fam237b A T 5: 5,625,652 (GRCm39) Q116L possibly damaging Het
Fat3 T C 9: 16,288,281 (GRCm39) Y414C probably benign Het
Fbxo10 C A 4: 45,046,389 (GRCm39) A574S probably damaging Het
Fsip2 G T 2: 82,807,906 (GRCm39) L1408F probably benign Het
Fubp3 T C 2: 31,501,747 (GRCm39) V425A possibly damaging Het
Gm7168 A T 17: 14,169,846 (GRCm39) R404S probably benign Het
Gpd1 T G 15: 99,621,083 (GRCm39) F299C probably damaging Het
Gpr137 C T 19: 6,919,425 (GRCm39) probably benign Het
Grin3b T C 10: 79,809,242 (GRCm39) S331P probably benign Het
Grk3 T A 5: 113,089,584 (GRCm39) I281F probably damaging Het
Hoxb7 T A 11: 96,177,607 (GRCm39) S18R probably damaging Het
Igf1r C T 7: 67,864,681 (GRCm39) R1160* probably null Het
Itfg1 A G 8: 86,452,141 (GRCm39) probably null Het
Itgb8 T C 12: 119,166,190 (GRCm39) I114V probably benign Het
Kcnk1 A G 8: 126,752,123 (GRCm39) E243G possibly damaging Het
Kif27 A G 13: 58,491,822 (GRCm39) L439P probably damaging Het
Kif2c T A 4: 117,024,558 (GRCm39) Q279L probably benign Het
Kmt2d A T 15: 98,749,955 (GRCm39) probably benign Het
L3mbtl1 A G 2: 162,816,422 (GRCm39) T821A probably benign Het
Lrrc24 A T 15: 76,606,778 (GRCm39) M206K probably benign Het
Mamdc4 T G 2: 25,457,634 (GRCm39) K460Q possibly damaging Het
Maml2 C G 9: 13,608,641 (GRCm39) L30V probably damaging Het
Mc5r C G 18: 68,471,741 (GRCm39) probably null Het
Myo10 T G 15: 25,726,611 (GRCm39) probably null Het
Myo1e T A 9: 70,246,066 (GRCm39) L419Q probably damaging Het
Myo6 C A 9: 80,207,854 (GRCm39) H1115Q probably damaging Het
Myo7a A G 7: 97,756,302 (GRCm39) V10A probably damaging Het
Myoz2 C T 3: 122,819,776 (GRCm39) R61H probably damaging Het
Ncdn G A 4: 126,645,796 (GRCm39) R38C probably damaging Het
Nckap1 T A 2: 80,350,900 (GRCm39) T736S probably benign Het
Ncor2 G A 5: 125,096,954 (GRCm39) A2325V probably damaging Het
Nid2 T A 14: 19,802,499 (GRCm39) V140E possibly damaging Het
Nlrp9c C A 7: 26,079,915 (GRCm39) D704Y probably benign Het
Notch3 T A 17: 32,377,699 (GRCm39) S126C probably damaging Het
Or2g7 T C 17: 38,378,839 (GRCm39) I259T probably damaging Het
Or5p60 A G 7: 107,724,122 (GRCm39) F116S probably benign Het
Or5w10 A T 2: 87,375,327 (GRCm39) L187H probably damaging Het
Or6c219 A T 10: 129,781,451 (GRCm39) L160* probably null Het
Or6c6c T C 10: 129,541,476 (GRCm39) M243T possibly damaging Het
Or6d15 A C 6: 116,559,658 (GRCm39) F83C probably damaging Het
Pdzd7 A G 19: 45,027,667 (GRCm39) I269T probably damaging Het
Phf3 A T 1: 30,845,287 (GRCm39) D1299E probably damaging Het
Pitx2 T A 3: 129,012,403 (GRCm39) Y271N probably damaging Het
Polk T C 13: 96,633,140 (GRCm39) E301G probably damaging Het
Prkdc C A 16: 15,557,388 (GRCm39) N2230K probably damaging Het
Prlr A G 15: 10,322,622 (GRCm39) E170G probably benign Het
Prss55 A G 14: 64,313,179 (GRCm39) I235T probably damaging Het
Psd3 T C 8: 68,413,217 (GRCm39) I724V probably benign Het
Rabep2 A G 7: 126,037,971 (GRCm39) T248A possibly damaging Het
Rbm26 T A 14: 105,354,509 (GRCm39) K949N probably benign Het
Rnf213 T A 11: 119,331,047 (GRCm39) D2085E probably damaging Het
Serpinb7 A T 1: 107,378,003 (GRCm39) H232L possibly damaging Het
Slu7 A G 11: 43,336,069 (GRCm39) Q484R probably benign Het
Smg1 A G 7: 117,745,021 (GRCm39) S3044P possibly damaging Het
Snrnp48 A G 13: 38,405,336 (GRCm39) D248G possibly damaging Het
Snrpc C A 17: 28,064,193 (GRCm39) P66Q unknown Het
Snrpn T A 7: 59,633,207 (GRCm39) probably benign Het
Spag17 T A 3: 99,846,672 (GRCm39) S65R possibly damaging Het
Srsf6 C A 2: 162,776,408 (GRCm39) probably benign Het
Stil T A 4: 114,898,979 (GRCm39) M1203K probably benign Het
Syt17 T C 7: 118,036,061 (GRCm39) T106A probably benign Het
Tbx15 C T 3: 99,259,562 (GRCm39) Q478* probably null Het
Tg A T 15: 66,609,397 (GRCm39) Q319L probably benign Het
Thada A G 17: 84,755,461 (GRCm39) L243P probably damaging Het
Thada G T 17: 84,755,462 (GRCm39) L243I probably damaging Het
Tnnt3 A G 7: 142,066,101 (GRCm39) R211G probably damaging Het
Togaram1 A T 12: 65,049,409 (GRCm39) Q1282L possibly damaging Het
Tpm3-rs7 T G 14: 113,552,379 (GRCm39) M91R probably damaging Het
Trappc9 G A 15: 72,897,816 (GRCm39) R377W probably damaging Het
Ttll7 T G 3: 146,621,535 (GRCm39) L378R probably damaging Het
Tyw1 T G 5: 130,287,834 (GRCm39) I22R probably damaging Het
Ubr3 T C 2: 69,846,711 (GRCm39) S1645P possibly damaging Het
Ubr4 T C 4: 139,120,364 (GRCm39) L263P probably damaging Het
Unc13c T C 9: 73,663,621 (GRCm39) E1071G possibly damaging Het
Vmn2r44 G T 7: 8,383,122 (GRCm39) D157E possibly damaging Het
Washc4 T C 10: 83,415,389 (GRCm39) V793A possibly damaging Het
Wdr35 G T 12: 9,027,435 (GRCm39) probably null Het
Zfp277 A G 12: 40,414,084 (GRCm39) F254L probably benign Het
Other mutations in Vps16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Vps16 APN 2 130,279,616 (GRCm39) missense probably benign 0.19
IGL01400:Vps16 APN 2 130,280,273 (GRCm39) missense possibly damaging 0.73
IGL01542:Vps16 APN 2 130,280,314 (GRCm39) missense probably damaging 0.97
IGL02011:Vps16 APN 2 130,283,399 (GRCm39) missense probably benign 0.04
IGL02192:Vps16 APN 2 130,282,852 (GRCm39) missense probably damaging 0.98
IGL02220:Vps16 APN 2 130,283,573 (GRCm39) missense possibly damaging 0.85
IGL02587:Vps16 APN 2 130,281,636 (GRCm39) critical splice donor site probably null
R0427:Vps16 UTSW 2 130,280,770 (GRCm39) missense probably benign 0.00
R0507:Vps16 UTSW 2 130,279,632 (GRCm39) critical splice donor site probably null
R1550:Vps16 UTSW 2 130,282,260 (GRCm39) missense probably benign 0.09
R3895:Vps16 UTSW 2 130,280,596 (GRCm39) missense possibly damaging 0.96
R3981:Vps16 UTSW 2 130,284,514 (GRCm39) missense possibly damaging 0.77
R4092:Vps16 UTSW 2 130,281,832 (GRCm39) missense probably damaging 1.00
R4555:Vps16 UTSW 2 130,285,496 (GRCm39) missense probably damaging 1.00
R4569:Vps16 UTSW 2 130,284,124 (GRCm39) missense probably benign
R4803:Vps16 UTSW 2 130,280,030 (GRCm39) missense probably benign 0.27
R4835:Vps16 UTSW 2 130,280,220 (GRCm39) splice site probably benign
R5022:Vps16 UTSW 2 130,281,372 (GRCm39) missense probably benign 0.07
R5023:Vps16 UTSW 2 130,281,372 (GRCm39) missense probably benign 0.07
R5057:Vps16 UTSW 2 130,281,372 (GRCm39) missense probably benign 0.07
R5158:Vps16 UTSW 2 130,283,199 (GRCm39) missense probably damaging 1.00
R5177:Vps16 UTSW 2 130,285,288 (GRCm39) nonsense probably null
R5540:Vps16 UTSW 2 130,284,305 (GRCm39) missense probably benign 0.00
R5680:Vps16 UTSW 2 130,282,244 (GRCm39) missense possibly damaging 0.64
R5689:Vps16 UTSW 2 130,281,011 (GRCm39) nonsense probably null
R5690:Vps16 UTSW 2 130,281,011 (GRCm39) nonsense probably null
R5926:Vps16 UTSW 2 130,285,476 (GRCm39) missense probably damaging 0.97
R5992:Vps16 UTSW 2 130,266,369 (GRCm39) critical splice donor site probably null
R6135:Vps16 UTSW 2 130,280,573 (GRCm39) missense possibly damaging 0.57
R6370:Vps16 UTSW 2 130,285,304 (GRCm39) missense probably damaging 1.00
R6898:Vps16 UTSW 2 130,279,601 (GRCm39) missense possibly damaging 0.74
R7378:Vps16 UTSW 2 130,280,099 (GRCm39) missense probably damaging 1.00
R7487:Vps16 UTSW 2 130,280,977 (GRCm39) nonsense probably null
R7641:Vps16 UTSW 2 130,282,448 (GRCm39) missense probably benign 0.28
R7720:Vps16 UTSW 2 130,283,623 (GRCm39) nonsense probably null
R8246:Vps16 UTSW 2 130,280,793 (GRCm39) missense probably damaging 1.00
R8363:Vps16 UTSW 2 130,284,161 (GRCm39) missense probably benign 0.08
R9092:Vps16 UTSW 2 130,281,593 (GRCm39) missense probably damaging 0.99
R9128:Vps16 UTSW 2 130,266,319 (GRCm39) missense possibly damaging 0.51
R9352:Vps16 UTSW 2 130,283,823 (GRCm39) critical splice donor site probably null
R9406:Vps16 UTSW 2 130,283,425 (GRCm39) critical splice donor site probably null
R9508:Vps16 UTSW 2 130,284,361 (GRCm39) missense possibly damaging 0.94
R9800:Vps16 UTSW 2 130,282,405 (GRCm39) missense probably benign 0.02
RF021:Vps16 UTSW 2 130,280,129 (GRCm39) missense probably benign 0.09
Z1177:Vps16 UTSW 2 130,283,346 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAAGGTCAAGGCTTTGCTTC -3'
(R):5'- CAGTTTTGCCTCAAAGCCTGC -3'

Sequencing Primer
(F):5'- AAGTTAGATGAAGGCCTCTGTG -3'
(R):5'- CTTTTCTTAAGCCAGACAGCATAC -3'
Posted On 2014-06-23