Incidental Mutation 'R0090:Stac3'
ID20159
Institutional Source Beutler Lab
Gene Symbol Stac3
Ensembl Gene ENSMUSG00000040287
Gene NameSH3 and cysteine rich domain 3
Synonyms
MMRRC Submission 038377-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0090 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127501686-127508823 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 127503930 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000035839] [ENSMUST00000064793] [ENSMUST00000077046] [ENSMUST00000105249] [ENSMUST00000105250] [ENSMUST00000105251] [ENSMUST00000160019] [ENSMUST00000160610] [ENSMUST00000166820] [ENSMUST00000169888] [ENSMUST00000170336]
Predicted Effect probably benign
Transcript: ENSMUST00000035839
SMART Domains Protein: ENSMUSP00000048148
Gene: ENSMUSG00000040287

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
C1 89 139 2.19e-7 SMART
low complexity region 199 213 N/A INTRINSIC
low complexity region 220 238 N/A INTRINSIC
SH3 246 301 1.41e-16 SMART
SH3 305 360 8.45e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064793
SMART Domains Protein: ENSMUSP00000069724
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 699 730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077046
SMART Domains Protein: ENSMUSP00000076303
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 7.4e-14 PFAM
low complexity region 338 350 N/A INTRINSIC
low complexity region 430 461 N/A INTRINSIC
low complexity region 474 499 N/A INTRINSIC
low complexity region 744 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105249
SMART Domains Protein: ENSMUSP00000100884
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.4e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 692 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105250
SMART Domains Protein: ENSMUSP00000100885
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.6e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 456 481 N/A INTRINSIC
low complexity region 726 757 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105251
SMART Domains Protein: ENSMUSP00000100886
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.6e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 456 481 N/A INTRINSIC
low complexity region 726 757 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160019
SMART Domains Protein: ENSMUSP00000125124
Gene: ENSMUSG00000040287

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
C1 89 139 2.19e-7 SMART
low complexity region 199 213 N/A INTRINSIC
low complexity region 220 238 N/A INTRINSIC
SH3 246 301 1.41e-16 SMART
SH3 305 360 8.45e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162302
Predicted Effect probably benign
Transcript: ENSMUST00000166820
SMART Domains Protein: ENSMUSP00000126608
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.7e-12 PFAM
low complexity region 338 350 N/A INTRINSIC
low complexity region 430 461 N/A INTRINSIC
low complexity region 474 499 N/A INTRINSIC
low complexity region 744 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169888
SMART Domains Protein: ENSMUSP00000126760
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
Pfam:SUZ 7 54 4.7e-12 PFAM
low complexity region 71 83 N/A INTRINSIC
low complexity region 163 194 N/A INTRINSIC
low complexity region 443 474 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170336
SMART Domains Protein: ENSMUSP00000128659
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 442 467 N/A INTRINSIC
low complexity region 712 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171426
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.7%
  • 20x: 91.4%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the excitation-contraction coupling machinery of muscles. This protein is a member of the Stac gene family and contains an N-terminal cysteine-rich domain and two SH3 domains. Mutations in this gene are a cause of Native American myopathy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to neonatal lethality, abnormal posture, thin diaphragm muscle, abnormal skeletal muscle morphology characterized by centralized nuclei and disorganized myofibrils, and impaired skeletal muscle contractility due to defective excitation-contraction coupling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
4933427I04Rik A G 4: 123,860,982 T230A possibly damaging Het
9230110C19Rik T A 9: 8,027,183 N118I probably benign Het
Acsm1 T C 7: 119,662,189 probably benign Het
Acta1 T C 8: 123,893,657 N14S probably damaging Het
Aff4 A G 11: 53,392,782 T362A probably benign Het
Aggf1 A G 13: 95,364,959 I305T probably benign Het
Ap4b1 A G 3: 103,820,429 D325G possibly damaging Het
Ap4e1 C T 2: 127,064,985 T1055I possibly damaging Het
Arhgef2 A T 3: 88,639,348 Q496L probably damaging Het
Arhgef28 A G 13: 98,075,110 F122L probably damaging Het
Baiap3 G A 17: 25,250,070 probably benign Het
Casp8ap2 T A 4: 32,640,327 H460Q probably damaging Het
Casz1 A G 4: 148,933,411 T386A probably benign Het
Cd53 A T 3: 106,767,409 V114E possibly damaging Het
Celsr2 A G 3: 108,393,327 probably benign Het
Chaf1b G T 16: 93,887,124 A88S possibly damaging Het
Cldn10 A T 14: 118,874,200 Y194F probably damaging Het
Clec2e A C 6: 129,095,218 probably null Het
Cmpk2 A T 12: 26,478,022 T413S probably benign Het
Col9a1 T A 1: 24,223,562 probably null Het
Dchs1 G T 7: 105,755,932 Q2468K probably benign Het
Ddx60 A G 8: 61,942,293 D88G probably damaging Het
Dnah8 A G 17: 30,784,090 R3588G probably benign Het
Ect2 T C 3: 27,115,476 T774A probably benign Het
Ect2 C T 3: 27,138,502 E431K probably null Het
Ern1 A G 11: 106,405,823 V767A probably damaging Het
Fbln1 A C 15: 85,224,288 E75A possibly damaging Het
Fgf5 C T 5: 98,261,987 R132* probably null Het
Folh1 T C 7: 86,725,868 probably benign Het
Gdf15 A T 8: 70,629,684 H257Q probably damaging Het
Ghitm T C 14: 37,122,219 T322A probably benign Het
Gm13212 A T 4: 145,622,625 K211* probably null Het
Gm5709 A G 3: 59,618,771 noncoding transcript Het
Hbb-y C T 7: 103,852,743 probably null Het
Hmcn2 A T 2: 31,426,198 D3771V probably damaging Het
Hspa12a T C 19: 58,799,509 D627G probably benign Het
Idh2 T C 7: 80,097,914 E286G probably damaging Het
Idh3b C A 2: 130,280,979 A297S probably benign Het
Igsf3 A G 3: 101,435,652 E535G probably damaging Het
Ilf3 T A 9: 21,395,414 D314E probably damaging Het
Itgb8 A G 12: 119,202,563 S78P probably benign Het
Itih5 G A 2: 10,164,684 V31I probably benign Het
Kcnj2 T C 11: 111,073,027 V415A probably benign Het
Kin A G 2: 10,085,773 Q53R possibly damaging Het
Krt78 A T 15: 101,947,837 M513K probably benign Het
Krtap4-8 A T 11: 99,780,486 probably benign Het
Ltbr T C 6: 125,309,449 probably benign Het
Mgat4a G A 1: 37,490,333 T146I probably damaging Het
Mrps2 G C 2: 28,468,256 W19C probably damaging Het
Mthfs T C 9: 89,211,291 S33P probably damaging Het
Myh6 T C 14: 54,958,704 D546G probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Ndst2 T C 14: 20,727,267 T553A probably damaging Het
Nlrp12 T C 7: 3,240,034 E616G probably damaging Het
Nrde2 T C 12: 100,129,286 probably benign Het
Nup210l G A 3: 90,211,779 V1832I probably benign Het
Olfr1283 A T 2: 111,369,294 I221F probably damaging Het
Olfr376 G A 11: 73,375,576 V276I probably benign Het
Pcm1 A T 8: 41,256,041 E9D probably damaging Het
Pear1 A T 3: 87,754,342 D541E possibly damaging Het
Peg10 A G 6: 4,756,063 probably benign Het
Prss1 G A 6: 41,461,232 R31Q probably benign Het
Ptpn13 T C 5: 103,569,503 V1837A probably damaging Het
Rasgrp3 A G 17: 75,498,461 D149G probably damaging Het
Reg3d A T 6: 78,378,483 H8Q possibly damaging Het
Rhox4f A C X: 37,607,469 V15G probably benign Het
Sacs T A 14: 61,205,440 L1645H probably damaging Het
Slc16a5 A T 11: 115,464,925 S71C probably damaging Het
Slc9a3 A G 13: 74,158,728 E324G probably damaging Het
Smgc T C 15: 91,859,762 V574A possibly damaging Het
Supv3l1 A G 10: 62,429,706 L685P probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tas2r125 G T 6: 132,910,398 A250S probably benign Het
Tdrd6 C T 17: 43,628,241 V639I probably benign Het
Thap12 T G 7: 98,715,893 W423G probably damaging Het
Tmem245 T C 4: 56,899,410 I217V probably benign Het
Trip12 T A 1: 84,732,136 probably benign Het
Tshz3 T C 7: 36,768,892 V102A probably benign Het
Ubap1 T C 4: 41,379,826 S347P probably damaging Het
Usp10 C T 8: 119,953,196 Q612* probably null Het
Vmn2r72 T C 7: 85,754,876 I36V probably benign Het
Vps37a T C 8: 40,526,989 I63T possibly damaging Het
Whrn C A 4: 63,432,732 R9L possibly damaging Het
Xrcc1 T C 7: 24,570,217 Y401H probably damaging Het
Ylpm1 GCCTAAGCAGCAACCTAAG GCCTAAG 12: 85,029,040 probably benign Het
Zfhx3 G A 8: 108,950,057 D2580N possibly damaging Het
Zfhx4 A G 3: 5,243,625 N637S probably damaging Het
Zyg11a A T 4: 108,201,347 probably benign Het
Other mutations in Stac3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Stac3 APN 10 127503664 missense probably damaging 1.00
IGL02271:Stac3 APN 10 127503899 missense probably benign 0.00
R0051:Stac3 UTSW 10 127508148 missense probably damaging 0.98
R0131:Stac3 UTSW 10 127503650 missense probably damaging 0.97
R0131:Stac3 UTSW 10 127503650 missense probably damaging 0.97
R0132:Stac3 UTSW 10 127503650 missense probably damaging 0.97
R0330:Stac3 UTSW 10 127507747 splice site probably null
R0630:Stac3 UTSW 10 127507763 missense probably damaging 1.00
R1132:Stac3 UTSW 10 127507259 missense probably benign
R1450:Stac3 UTSW 10 127504885 missense probably damaging 1.00
R1739:Stac3 UTSW 10 127507766 missense probably benign 0.40
R2316:Stac3 UTSW 10 127503360 splice site probably null
R2511:Stac3 UTSW 10 127503918 critical splice donor site probably null
R3000:Stac3 UTSW 10 127508147 missense probably benign 0.01
R4324:Stac3 UTSW 10 127503249 missense probably damaging 0.99
R4758:Stac3 UTSW 10 127503345 missense possibly damaging 0.95
R5040:Stac3 UTSW 10 127508124 missense probably damaging 0.98
R6244:Stac3 UTSW 10 127508175 missense probably damaging 1.00
R6275:Stac3 UTSW 10 127507746 nonsense probably null
R7335:Stac3 UTSW 10 127504900 missense probably benign 0.22
R8191:Stac3 UTSW 10 127508199 missense probably damaging 1.00
R8290:Stac3 UTSW 10 127503360 splice site probably null
R8410:Stac3 UTSW 10 127503330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGACTCCGCTGCAAGAACTG -3'
(R):5'- AAAAGGAGCTGTACTGCTGGCCTG -3'

Sequencing Primer
(F):5'- ATGAGCATTGTCAGTCCTACG -3'
(R):5'- GCTGGCCTGCTCATTCAC -3'
Posted On2013-04-11