Incidental Mutation 'R1789:Pitx2'
ID201594
Institutional Source Beutler Lab
Gene Symbol Pitx2
Ensembl Gene ENSMUSG00000028023
Gene Namepaired-like homeodomain transcription factor 2
SynonymsPitx2b, Pitx2a, Brx1, solurshin, Brx1a, Brx1b, Ptx2, Otlx2, Pitx2c, Rieg, Munc30
MMRRC Submission 039820-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1789 (G1)
Quality Score126
Status Not validated
Chromosome3
Chromosomal Location129199878-129219591 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129218754 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 271 (Y271N)
Ref Sequence ENSEMBL: ENSMUSP00000133756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029657] [ENSMUST00000042587] [ENSMUST00000106382] [ENSMUST00000172645] [ENSMUST00000174623] [ENSMUST00000174661]
Predicted Effect probably benign
Transcript: ENSMUST00000029657
Predicted Effect probably damaging
Transcript: ENSMUST00000042587
AA Change: Y278N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047359
Gene: ENSMUSG00000028023
AA Change: Y278N

DomainStartEndE-ValueType
HOX 92 154 6.5e-26 SMART
low complexity region 213 236 N/A INTRINSIC
low complexity region 244 262 N/A INTRINSIC
low complexity region 263 280 N/A INTRINSIC
Pfam:OAR 282 300 4.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106382
AA Change: Y225N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101990
Gene: ENSMUSG00000028023
AA Change: Y225N

DomainStartEndE-ValueType
HOX 39 101 6.5e-26 SMART
low complexity region 160 183 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
Pfam:OAR 228 248 2.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172645
AA Change: Y258N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134692
Gene: ENSMUSG00000028023
AA Change: Y258N

DomainStartEndE-ValueType
HOX 72 134 6.5e-26 SMART
low complexity region 193 216 N/A INTRINSIC
low complexity region 224 242 N/A INTRINSIC
low complexity region 243 260 N/A INTRINSIC
Pfam:OAR 262 280 9.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174623
SMART Domains Protein: ENSMUSP00000139328
Gene: ENSMUSG00000028023

DomainStartEndE-ValueType
HOX 92 151 1.37e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174661
AA Change: Y271N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133756
Gene: ENSMUSG00000028023
AA Change: Y271N

DomainStartEndE-ValueType
HOX 85 147 6.5e-26 SMART
low complexity region 206 229 N/A INTRINSIC
low complexity region 237 255 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
Pfam:OAR 274 294 1.8e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199637
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. The encoded protein acts as a transcription factor and regulates procollagen lysyl hydroxylase gene expression. This protein plays a role in the terminal differentiation of somatotroph and lactotroph cell phenotypes, is involved in the development of the eye, tooth and abdominal organs, and acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. Mutations in this gene are associated with Axenfeld-Rieger syndrome, iridogoniodysgenesis syndrome, and sporadic cases of Peters anomaly. A similar protein in other vertebrates is involved in the determination of left-right asymmetry during development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations show failed ventral body wall closure, right pulmonary isomerism, septal and valve defects, absent ocular muscles, arrested pituitary and tooth development, optic nerve, mandible and maxilla defects, and embryonic death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G A 16: 20,365,951 P986L probably damaging Het
Acad10 A T 5: 121,631,393 Y667N possibly damaging Het
Ahi1 G A 10: 20,963,115 G121D probably benign Het
Ampd1 T A 3: 103,099,126 I690N possibly damaging Het
Amy1 C A 3: 113,558,165 W425L possibly damaging Het
Arhgap27 A T 11: 103,333,005 V823E probably damaging Het
Arhgef17 A G 7: 100,929,870 S624P probably damaging Het
Arid5b T C 10: 68,186,067 H231R probably damaging Het
Aspscr1 C A 11: 120,688,560 T78N probably damaging Het
Auts2 T A 5: 131,472,450 T42S probably damaging Het
Ccdc171 A G 4: 83,554,808 D158G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap61 T C 2: 145,939,993 probably null Het
Chrna5 T C 9: 55,004,651 V245A possibly damaging Het
Cntnap5c G A 17: 58,013,921 G163R probably damaging Het
Col5a2 A G 1: 45,378,305 probably null Het
Col5a2 T C 1: 45,394,776 Q759R probably damaging Het
Comp A G 8: 70,377,146 D340G probably benign Het
Cyfip1 T A 7: 55,926,395 D1104E probably damaging Het
Dnah11 A T 12: 118,038,780 S308T probably damaging Het
Dnah5 A G 15: 28,270,426 H958R probably benign Het
Elp3 A G 14: 65,547,919 Y478H probably damaging Het
Fat3 T C 9: 16,376,985 Y414C probably benign Het
Fbxo10 C A 4: 45,046,389 A574S probably damaging Het
Fsip2 G T 2: 82,977,562 L1408F probably benign Het
Fubp3 T C 2: 31,611,735 V425A possibly damaging Het
Gm7168 A T 17: 13,949,584 R404S probably benign Het
Gm8773 A T 5: 5,575,652 Q116L possibly damaging Het
Gpd1 T G 15: 99,723,202 F299C probably damaging Het
Gpr137 C T 19: 6,942,057 probably benign Het
Grin3b T C 10: 79,973,408 S331P probably benign Het
Grk3 T A 5: 112,941,718 I281F probably damaging Het
Hoxb7 T A 11: 96,286,781 S18R probably damaging Het
Igf1r C T 7: 68,214,933 R1160* probably null Het
Itfg1 A G 8: 85,725,512 probably null Het
Itgb8 T C 12: 119,202,455 I114V probably benign Het
Kcnk1 A G 8: 126,025,384 E243G possibly damaging Het
Kif27 A G 13: 58,344,008 L439P probably damaging Het
Kif2c T A 4: 117,167,361 Q279L probably benign Het
Kmt2d A T 15: 98,852,074 probably benign Het
L3mbtl1 A G 2: 162,974,502 T821A probably benign Het
Lrrc24 A T 15: 76,722,578 M206K probably benign Het
Mamdc4 T G 2: 25,567,622 K460Q possibly damaging Het
Maml2 C G 9: 13,697,345 L30V probably damaging Het
Mc5r C G 18: 68,338,670 probably null Het
Myo10 T G 15: 25,726,525 probably null Het
Myo1e T A 9: 70,338,784 L419Q probably damaging Het
Myo6 C A 9: 80,300,572 H1115Q probably damaging Het
Myo7a A G 7: 98,107,095 V10A probably damaging Het
Myoz2 C T 3: 123,026,127 R61H probably damaging Het
Ncdn G A 4: 126,752,003 R38C probably damaging Het
Nckap1 T A 2: 80,520,556 T736S probably benign Het
Ncor2 G A 5: 125,019,890 A2325V probably damaging Het
Nid2 T A 14: 19,752,431 V140E possibly damaging Het
Nlrp9c C A 7: 26,380,490 D704Y probably benign Het
Notch3 T A 17: 32,158,725 S126C probably damaging Het
Olfr1128 A T 2: 87,544,983 L187H probably damaging Het
Olfr130 T C 17: 38,067,948 I259T probably damaging Het
Olfr215 A C 6: 116,582,697 F83C probably damaging Het
Olfr484 A G 7: 108,124,915 F116S probably benign Het
Olfr804 T C 10: 129,705,607 M243T possibly damaging Het
Olfr818 A T 10: 129,945,582 L160* probably null Het
Pdzd7 A G 19: 45,039,228 I269T probably damaging Het
Phf3 A T 1: 30,806,206 D1299E probably damaging Het
Polk T C 13: 96,496,632 E301G probably damaging Het
Prkdc C A 16: 15,739,524 N2230K probably damaging Het
Prlr A G 15: 10,322,536 E170G probably benign Het
Prss55 A G 14: 64,075,730 I235T probably damaging Het
Psd3 T C 8: 67,960,565 I724V probably benign Het
Rabep2 A G 7: 126,438,799 T248A possibly damaging Het
Rbm26 T A 14: 105,117,073 K949N probably benign Het
Rnf213 T A 11: 119,440,221 D2085E probably damaging Het
Serpinb7 A T 1: 107,450,273 H232L possibly damaging Het
Slu7 A G 11: 43,445,242 Q484R probably benign Het
Smg1 A G 7: 118,145,798 S3044P possibly damaging Het
Snrnp48 A G 13: 38,221,360 D248G possibly damaging Het
Snrpc C A 17: 27,845,219 P66Q unknown Het
Snrpn T A 7: 59,983,459 probably benign Het
Spag17 T A 3: 99,939,356 S65R possibly damaging Het
Srsf6 C A 2: 162,934,488 probably benign Het
Stil T A 4: 115,041,782 M1203K probably benign Het
Syt17 T C 7: 118,436,838 T106A probably benign Het
Tbx15 C T 3: 99,352,246 Q478* probably null Het
Tg A T 15: 66,737,548 Q319L probably benign Het
Thada A G 17: 84,448,033 L243P probably damaging Het
Thada G T 17: 84,448,034 L243I probably damaging Het
Tnnt3 A G 7: 142,512,364 R211G probably damaging Het
Togaram1 A T 12: 65,002,635 Q1282L possibly damaging Het
Tpm3-rs7 T G 14: 113,314,947 M91R probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Ttll7 T G 3: 146,915,780 L378R probably damaging Het
Tyw1 T G 5: 130,258,993 I22R probably damaging Het
Ubr3 T C 2: 70,016,367 S1645P possibly damaging Het
Ubr4 T C 4: 139,393,053 L263P probably damaging Het
Unc13c T C 9: 73,756,339 E1071G possibly damaging Het
Vmn2r44 G T 7: 8,380,123 D157E possibly damaging Het
Vps16 C T 2: 130,443,600 T821I probably benign Het
Washc4 T C 10: 83,579,525 V793A possibly damaging Het
Wdr35 G T 12: 8,977,435 probably null Het
Zfp277 A G 12: 40,364,085 F254L probably benign Het
Other mutations in Pitx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Pitx2 APN 3 129214764 missense probably damaging 0.99
IGL02110:Pitx2 APN 3 129218817 missense probably damaging 0.99
R0014:Pitx2 UTSW 3 129218499 missense possibly damaging 0.70
R1083:Pitx2 UTSW 3 129218769 missense probably damaging 1.00
R1474:Pitx2 UTSW 3 129218839 missense probably damaging 1.00
R1945:Pitx2 UTSW 3 129218536 missense probably damaging 1.00
R5305:Pitx2 UTSW 3 129215840 missense probably damaging 1.00
R5950:Pitx2 UTSW 3 129218520 missense probably damaging 1.00
R6114:Pitx2 UTSW 3 129204413 intron probably null
R6189:Pitx2 UTSW 3 129218469 missense probably damaging 1.00
R6192:Pitx2 UTSW 3 129215872 missense probably benign 0.09
R6226:Pitx2 UTSW 3 129215842 missense probably damaging 1.00
R6526:Pitx2 UTSW 3 129214783 critical splice donor site probably null
R6778:Pitx2 UTSW 3 129218743 missense probably damaging 1.00
R6885:Pitx2 UTSW 3 129218608 missense probably damaging 1.00
R7575:Pitx2 UTSW 3 129215726 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTATGTTTTCCCCGCCC -3'
(R):5'- CTAGCACAATTCTCAGTCTTTCTGG -3'

Sequencing Primer
(F):5'- GCCCAACTCCATCTCATCTATG -3'
(R):5'- AGTTGCCCACTCCGACAGTC -3'
Posted On2014-06-23