Mutagenetix > Incidental Mutation

Incidental Mutation 'R1789:Stil'

201598

Institutional Source

Beutler Lab

Gene Symbol

Stil

Ensembl Gene

ENSMUSG00000028718

Gene Name

Scl/Tal1 interrupting locus

Synonyms

Sil

MMRRC Submission

039820-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1789 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115000159-115043196 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 115041782 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1203 (M1203K)

Ref Sequence

ENSEMBL: ENSMUSP00000030490 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030490] [ENSMUST00000129957] [ENSMUST00000141933]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000030490
AA Change: M1203K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000030490
Gene: ENSMUSG00000028718
AA Change: M1203K

Domain	Start	End	E-Value	Type
Pfam:STIL_N	22	426	5.1e-199	PFAM
low complexity region	709	724	N/A	INTRINSIC
low complexity region	1106	1118	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129957

SMART Domains

Protein: ENSMUSP00000123385
Gene: ENSMUSG00000028718

Domain	Start	End	E-Value	Type
Pfam:STIL_N	22	416	1.5e-180	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000141933

SMART Domains

Protein: ENSMUSP00000118849
Gene: ENSMUSG00000028718

Domain	Start	End	E-Value	Type
Pfam:STIL_N	22	392	6.6e-166	PFAM

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a centrosomal protein ubiquitously expressed in proliferating cells and during early embryonic development. Mice lacking the encoded protein die in utero with marked growth retardation, defects in the developing neural fold and randomization of left-right asymmetry. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos with various neural tube defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	G	A	16: 20,365,951	P986L	probably damaging	Het
Acad10	A	T	5: 121,631,393	Y667N	possibly damaging	Het
Ahi1	G	A	10: 20,963,115	G121D	probably benign	Het
Ampd1	T	A	3: 103,099,126	I690N	possibly damaging	Het
Amy1	C	A	3: 113,558,165	W425L	possibly damaging	Het
Arhgap27	A	T	11: 103,333,005	V823E	probably damaging	Het
Arhgef17	A	G	7: 100,929,870	S624P	probably damaging	Het
Arid5b	T	C	10: 68,186,067	H231R	probably damaging	Het
Aspscr1	C	A	11: 120,688,560	T78N	probably damaging	Het
Auts2	T	A	5: 131,472,450	T42S	probably damaging	Het
Ccdc171	A	G	4: 83,554,808	D158G	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap61	T	C	2: 145,939,993		probably null	Het
Chrna5	T	C	9: 55,004,651	V245A	possibly damaging	Het
Cntnap5c	G	A	17: 58,013,921	G163R	probably damaging	Het
Col5a2	A	G	1: 45,378,305		probably null	Het
Col5a2	T	C	1: 45,394,776	Q759R	probably damaging	Het
Comp	A	G	8: 70,377,146	D340G	probably benign	Het
Cyfip1	T	A	7: 55,926,395	D1104E	probably damaging	Het
Dnah11	A	T	12: 118,038,780	S308T	probably damaging	Het
Dnah5	A	G	15: 28,270,426	H958R	probably benign	Het
Elp3	A	G	14: 65,547,919	Y478H	probably damaging	Het
Fat3	T	C	9: 16,376,985	Y414C	probably benign	Het
Fbxo10	C	A	4: 45,046,389	A574S	probably damaging	Het
Fsip2	G	T	2: 82,977,562	L1408F	probably benign	Het
Fubp3	T	C	2: 31,611,735	V425A	possibly damaging	Het
Gm7168	A	T	17: 13,949,584	R404S	probably benign	Het
Gm8773	A	T	5: 5,575,652	Q116L	possibly damaging	Het
Gpd1	T	G	15: 99,723,202	F299C	probably damaging	Het
Gpr137	C	T	19: 6,942,057		probably benign	Het
Grin3b	T	C	10: 79,973,408	S331P	probably benign	Het
Grk3	T	A	5: 112,941,718	I281F	probably damaging	Het
Hoxb7	T	A	11: 96,286,781	S18R	probably damaging	Het
Igf1r	C	T	7: 68,214,933	R1160*	probably null	Het
Itfg1	A	G	8: 85,725,512		probably null	Het
Itgb8	T	C	12: 119,202,455	I114V	probably benign	Het
Kcnk1	A	G	8: 126,025,384	E243G	possibly damaging	Het
Kif27	A	G	13: 58,344,008	L439P	probably damaging	Het
Kif2c	T	A	4: 117,167,361	Q279L	probably benign	Het
Kmt2d	A	T	15: 98,852,074		probably benign	Het
L3mbtl1	A	G	2: 162,974,502	T821A	probably benign	Het
Lrrc24	A	T	15: 76,722,578	M206K	probably benign	Het
Mamdc4	T	G	2: 25,567,622	K460Q	possibly damaging	Het
Maml2	C	G	9: 13,697,345	L30V	probably damaging	Het
Mc5r	C	G	18: 68,338,670		probably null	Het
Myo10	T	G	15: 25,726,525		probably null	Het
Myo1e	T	A	9: 70,338,784	L419Q	probably damaging	Het
Myo6	C	A	9: 80,300,572	H1115Q	probably damaging	Het
Myo7a	A	G	7: 98,107,095	V10A	probably damaging	Het
Myoz2	C	T	3: 123,026,127	R61H	probably damaging	Het
Ncdn	G	A	4: 126,752,003	R38C	probably damaging	Het
Nckap1	T	A	2: 80,520,556	T736S	probably benign	Het
Ncor2	G	A	5: 125,019,890	A2325V	probably damaging	Het
Nid2	T	A	14: 19,752,431	V140E	possibly damaging	Het
Nlrp9c	C	A	7: 26,380,490	D704Y	probably benign	Het
Notch3	T	A	17: 32,158,725	S126C	probably damaging	Het
Olfr1128	A	T	2: 87,544,983	L187H	probably damaging	Het
Olfr130	T	C	17: 38,067,948	I259T	probably damaging	Het
Olfr215	A	C	6: 116,582,697	F83C	probably damaging	Het
Olfr484	A	G	7: 108,124,915	F116S	probably benign	Het
Olfr804	T	C	10: 129,705,607	M243T	possibly damaging	Het
Olfr818	A	T	10: 129,945,582	L160*	probably null	Het
Pdzd7	A	G	19: 45,039,228	I269T	probably damaging	Het
Phf3	A	T	1: 30,806,206	D1299E	probably damaging	Het
Pitx2	T	A	3: 129,218,754	Y271N	probably damaging	Het
Polk	T	C	13: 96,496,632	E301G	probably damaging	Het
Prkdc	C	A	16: 15,739,524	N2230K	probably damaging	Het
Prlr	A	G	15: 10,322,536	E170G	probably benign	Het
Prss55	A	G	14: 64,075,730	I235T	probably damaging	Het
Psd3	T	C	8: 67,960,565	I724V	probably benign	Het
Rabep2	A	G	7: 126,438,799	T248A	possibly damaging	Het
Rbm26	T	A	14: 105,117,073	K949N	probably benign	Het
Rnf213	T	A	11: 119,440,221	D2085E	probably damaging	Het
Serpinb7	A	T	1: 107,450,273	H232L	possibly damaging	Het
Slu7	A	G	11: 43,445,242	Q484R	probably benign	Het
Smg1	A	G	7: 118,145,798	S3044P	possibly damaging	Het
Snrnp48	A	G	13: 38,221,360	D248G	possibly damaging	Het
Snrpc	C	A	17: 27,845,219	P66Q	unknown	Het
Snrpn	T	A	7: 59,983,459		probably benign	Het
Spag17	T	A	3: 99,939,356	S65R	possibly damaging	Het
Srsf6	C	A	2: 162,934,488		probably benign	Het
Syt17	T	C	7: 118,436,838	T106A	probably benign	Het
Tbx15	C	T	3: 99,352,246	Q478*	probably null	Het
Tg	A	T	15: 66,737,548	Q319L	probably benign	Het
Thada	A	G	17: 84,448,033	L243P	probably damaging	Het
Thada	G	T	17: 84,448,034	L243I	probably damaging	Het
Tnnt3	A	G	7: 142,512,364	R211G	probably damaging	Het
Togaram1	A	T	12: 65,002,635	Q1282L	possibly damaging	Het
Tpm3-rs7	T	G	14: 113,314,947	M91R	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Ttll7	T	G	3: 146,915,780	L378R	probably damaging	Het
Tyw1	T	G	5: 130,258,993	I22R	probably damaging	Het
Ubr3	T	C	2: 70,016,367	S1645P	possibly damaging	Het
Ubr4	T	C	4: 139,393,053	L263P	probably damaging	Het
Unc13c	T	C	9: 73,756,339	E1071G	possibly damaging	Het
Vmn2r44	G	T	7: 8,380,123	D157E	possibly damaging	Het
Vps16	C	T	2: 130,443,600	T821I	probably benign	Het
Washc4	T	C	10: 83,579,525	V793A	possibly damaging	Het
Wdr35	G	T	12: 8,977,435		probably null	Het
Zfp277	A	G	12: 40,364,085	F254L	probably benign	Het

Other mutations in Stil

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01506:Stil	APN	4	115024112	missense	probably benign	0.29
IGL01672:Stil	APN	4	115032789	missense	probably damaging	1.00
IGL02058:Stil	APN	4	115014162	missense	probably benign	0.00
IGL02076:Stil	APN	4	115023637	missense	probably benign	0.03
IGL02104:Stil	APN	4	115041482	missense	probably damaging	1.00
IGL02355:Stil	APN	4	115010111	missense	probably damaging	1.00
IGL02362:Stil	APN	4	115010111	missense	probably damaging	1.00
IGL02612:Stil	APN	4	115023696	missense	possibly damaging	0.80
IGL02695:Stil	APN	4	115016175	missense	probably damaging	1.00
IGL02696:Stil	APN	4	115041495	missense	probably damaging	0.99
IGL02826:Stil	APN	4	115024098	missense	probably benign	0.01
IGL02946:Stil	APN	4	115029913	missense	probably benign	0.05
IGL03146:Stil	APN	4	115024415	missense	probably damaging	1.00
BB005:Stil	UTSW	4	115030001	missense	probably damaging	0.98
BB015:Stil	UTSW	4	115030001	missense	probably damaging	0.98
R0058:Stil	UTSW	4	115041298	missense	probably damaging	1.00
R0256:Stil	UTSW	4	115023685	missense	possibly damaging	0.80
R0324:Stil	UTSW	4	115039149	missense	probably benign	0.01
R0391:Stil	UTSW	4	115041172	critical splice acceptor site	probably null
R0602:Stil	UTSW	4	115024423	splice site	probably benign
R0620:Stil	UTSW	4	115007159	missense	possibly damaging	0.52
R1452:Stil	UTSW	4	115039195	missense	probably benign	0.00
R1462:Stil	UTSW	4	115023964	missense	probably benign	0.00
R1462:Stil	UTSW	4	115023964	missense	probably benign	0.00
R1544:Stil	UTSW	4	115023852	missense	probably damaging	0.97
R1878:Stil	UTSW	4	115041226	missense	probably damaging	1.00
R1895:Stil	UTSW	4	115023875	missense	probably benign	0.40
R2325:Stil	UTSW	4	115032707	missense	probably benign	0.12
R2401:Stil	UTSW	4	115016286	missense	probably null	0.81
R3054:Stil	UTSW	4	115004966	missense	probably damaging	1.00
R3055:Stil	UTSW	4	115014069	splice site	probably benign
R4097:Stil	UTSW	4	115023600	missense	probably benign	0.04
R4330:Stil	UTSW	4	115004979	missense	probably damaging	1.00
R4418:Stil	UTSW	4	115009377	missense	probably benign	0.17
R4665:Stil	UTSW	4	115041644	missense	probably benign	0.00
R4688:Stil	UTSW	4	115041308	missense	probably damaging	1.00
R4740:Stil	UTSW	4	115006782	missense	probably benign	0.15
R4860:Stil	UTSW	4	115038474	missense	probably benign	0.01
R4860:Stil	UTSW	4	115038474	missense	probably benign	0.01
R4909:Stil	UTSW	4	115024225	nonsense	probably null
R6130:Stil	UTSW	4	115029861	splice site	probably null
R6523:Stil	UTSW	4	115032714	frame shift	probably null
R7294:Stil	UTSW	4	115007283	missense	probably benign	0.17
R7357:Stil	UTSW	4	115014226	critical splice donor site	probably null
R7387:Stil	UTSW	4	115024036	missense	probably benign	0.37
R7592:Stil	UTSW	4	115023808	missense	probably benign	0.00
R7776:Stil	UTSW	4	115032838	missense	possibly damaging	0.49
R7908:Stil	UTSW	4	115032699	missense	possibly damaging	0.68
R7928:Stil	UTSW	4	115030001	missense	probably damaging	0.98
R9064:Stil	UTSW	4	115041735	missense	probably benign	0.00
R9140:Stil	UTSW	4	115007252	missense	probably damaging	1.00
R9500:Stil	UTSW	4	115021519	missense	possibly damaging	0.93
R9695:Stil	UTSW	4	115024181	missense	probably damaging	1.00
R9697:Stil	UTSW	4	115021504	missense	probably benign	0.45
Z1088:Stil	UTSW	4	115006693	missense	probably damaging	1.00
Z1177:Stil	UTSW	4	115041379	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCCTTCTTGGAATGCCTGTG -3'
(R):5'- AGGTCTGGATTTCTTAAGTGCC -3'

Sequencing Primer
(F):5'- ATGCCTGTGAAATAGCTCAGTGC -3'
(R):5'- TTTCTTAAGTGCCATCAATACACACC -3'

Posted On

2014-06-23