Mutagenetix > Incidental Mutations

Incidental Mutation 'R1789:Myo7a'

201617

Institutional Source

Beutler Lab

Gene Symbol

Myo7a

Ensembl Gene

ENSMUSG00000030761

Gene Name

myosin VIIA

Synonyms

Myo7, nmf371, polka, Hdb, USH1B

MMRRC Submission

039820-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1789 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98051060-98119524 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 98107095 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 10 (V10A)

Ref Sequence

ENSEMBL: ENSMUSP00000114944 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084979] [ENSMUST00000107122] [ENSMUST00000107127] [ENSMUST00000107128] [ENSMUST00000138627] [ENSMUST00000205746]

Predicted Effect

probably benign
Transcript: ENSMUST00000084979

SMART Domains

Protein: ENSMUSP00000082046
Gene: ENSMUSG00000030761

Domain	Start	End	E-Value	Type
MYSc	48	731	N/A	SMART
IQ	732	754	2.99e0	SMART
IQ	755	777	8.77e-7	SMART
IQ	801	823	8e0	SMART
IQ	824	846	8.7e0	SMART
low complexity region	854	889	N/A	INTRINSIC
low complexity region	893	916	N/A	INTRINSIC
low complexity region	972	985	N/A	INTRINSIC
MyTH4	1006	1242	1.4e-71	SMART
B41	1243	1458	8.82e-42	SMART
SH3	1557	1622	4.93e-7	SMART
MyTH4	1698	1847	3.95e-57	SMART
B41	1849	2066	8.27e-56	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107122

SMART Domains

Protein: ENSMUSP00000102739
Gene: ENSMUSG00000030761

Domain	Start	End	E-Value	Type
MYSc	48	737	N/A	SMART
IQ	738	760	2.99e0	SMART
IQ	761	783	8.77e-7	SMART
IQ	807	829	8e0	SMART
IQ	830	852	8.7e0	SMART
low complexity region	860	895	N/A	INTRINSIC
low complexity region	899	922	N/A	INTRINSIC
low complexity region	978	991	N/A	INTRINSIC
MyTH4	1012	1248	1.4e-71	SMART
B41	1249	1464	8.82e-42	SMART
SH3	1563	1628	4.93e-7	SMART
MyTH4	1704	1853	3.95e-57	SMART
B41	1855	2072	8.27e-56	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107127
AA Change: V10A

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000102744
Gene: ENSMUSG00000030761
AA Change: V10A

Domain	Start	End	E-Value	Type
MYSc	59	742	N/A	SMART
IQ	743	765	2.99e0	SMART
IQ	766	788	8.77e-7	SMART
IQ	812	834	8e0	SMART
IQ	835	857	8.7e0	SMART
low complexity region	865	900	N/A	INTRINSIC
low complexity region	904	927	N/A	INTRINSIC
low complexity region	983	996	N/A	INTRINSIC
MyTH4	1017	1253	1.4e-71	SMART
B41	1254	1469	8.82e-42	SMART
SH3	1568	1633	4.93e-7	SMART
MyTH4	1709	1858	3.95e-57	SMART
B41	1860	2077	8.27e-56	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107128
AA Change: V10A

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000102745
Gene: ENSMUSG00000030761
AA Change: V10A

Domain	Start	End	E-Value	Type
MYSc	59	742	N/A	SMART
IQ	743	765	2.99e0	SMART
IQ	766	788	8.77e-7	SMART
IQ	812	834	8e0	SMART
IQ	835	857	8.7e0	SMART
low complexity region	865	900	N/A	INTRINSIC
low complexity region	904	927	N/A	INTRINSIC
low complexity region	983	996	N/A	INTRINSIC
MyTH4	1017	1253	1.4e-71	SMART
B41	1254	1469	8.82e-42	SMART
SH3	1606	1671	4.93e-7	SMART
MyTH4	1747	1896	3.95e-57	SMART
B41	1898	2115	8.27e-56	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131632

Predicted Effect

probably damaging
Transcript: ENSMUST00000138627
AA Change: V10A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000114944
Gene: ENSMUSG00000030761
AA Change: V10A

Domain	Start	End	E-Value	Type
Pfam:Myosin_head	67	139	7.1e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149079

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153657

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155637

Predicted Effect

probably benign
Transcript: ENSMUST00000205746

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myosin gene family. Myosins are mechanochemical proteins characterized by the presence of a motor domain, an actin-binding domain, a neck domain that interacts with other proteins, and a tail domain that serves as an anchor. This gene encodes an unconventional myosin with a very short tail. Defects in this gene are associated with the mouse shaker-1 phenotype and the human Usher syndrome 1B which are characterized by deafness, reduced vestibular function, and (in human) retinal degeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: A number of spontaneous and ENU-induced mutations cause head-shaking, circling and deafness, often associated with cochlear hair cell degeneration and stereocilia anomalies. Defects in retinal pigment epithelial cells, male infertility, and light-inducedphotoreceptor damage have also been observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	G	A	16: 20,365,951	P986L	probably damaging	Het
Acad10	A	T	5: 121,631,393	Y667N	possibly damaging	Het
Ahi1	G	A	10: 20,963,115	G121D	probably benign	Het
Ampd1	T	A	3: 103,099,126	I690N	possibly damaging	Het
Amy1	C	A	3: 113,558,165	W425L	possibly damaging	Het
Arhgap27	A	T	11: 103,333,005	V823E	probably damaging	Het
Arhgef17	A	G	7: 100,929,870	S624P	probably damaging	Het
Arid5b	T	C	10: 68,186,067	H231R	probably damaging	Het
Aspscr1	C	A	11: 120,688,560	T78N	probably damaging	Het
Auts2	T	A	5: 131,472,450	T42S	probably damaging	Het
Ccdc171	A	G	4: 83,554,808	D158G	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap61	T	C	2: 145,939,993		probably null	Het
Chrna5	T	C	9: 55,004,651	V245A	possibly damaging	Het
Cntnap5c	G	A	17: 58,013,921	G163R	probably damaging	Het
Col5a2	T	C	1: 45,394,776	Q759R	probably damaging	Het
Col5a2	A	G	1: 45,378,305		probably null	Het
Comp	A	G	8: 70,377,146	D340G	probably benign	Het
Cyfip1	T	A	7: 55,926,395	D1104E	probably damaging	Het
Dnah11	A	T	12: 118,038,780	S308T	probably damaging	Het
Dnah5	A	G	15: 28,270,426	H958R	probably benign	Het
Elp3	A	G	14: 65,547,919	Y478H	probably damaging	Het
Fat3	T	C	9: 16,376,985	Y414C	probably benign	Het
Fbxo10	C	A	4: 45,046,389	A574S	probably damaging	Het
Fsip2	G	T	2: 82,977,562	L1408F	probably benign	Het
Fubp3	T	C	2: 31,611,735	V425A	possibly damaging	Het
Gm7168	A	T	17: 13,949,584	R404S	probably benign	Het
Gm8773	A	T	5: 5,575,652	Q116L	possibly damaging	Het
Gpd1	T	G	15: 99,723,202	F299C	probably damaging	Het
Gpr137	C	T	19: 6,942,057		probably benign	Het
Grin3b	T	C	10: 79,973,408	S331P	probably benign	Het
Grk3	T	A	5: 112,941,718	I281F	probably damaging	Het
Hoxb7	T	A	11: 96,286,781	S18R	probably damaging	Het
Igf1r	C	T	7: 68,214,933	R1160*	probably null	Het
Itfg1	A	G	8: 85,725,512		probably null	Het
Itgb8	T	C	12: 119,202,455	I114V	probably benign	Het
Kcnk1	A	G	8: 126,025,384	E243G	possibly damaging	Het
Kif27	A	G	13: 58,344,008	L439P	probably damaging	Het
Kif2c	T	A	4: 117,167,361	Q279L	probably benign	Het
Kmt2d	A	T	15: 98,852,074		probably benign	Het
L3mbtl1	A	G	2: 162,974,502	T821A	probably benign	Het
Lrrc24	A	T	15: 76,722,578	M206K	probably benign	Het
Mamdc4	T	G	2: 25,567,622	K460Q	possibly damaging	Het
Maml2	C	G	9: 13,697,345	L30V	probably damaging	Het
Mc5r	C	G	18: 68,338,670		probably null	Het
Myo10	T	G	15: 25,726,525		probably null	Het
Myo1e	T	A	9: 70,338,784	L419Q	probably damaging	Het
Myo6	C	A	9: 80,300,572	H1115Q	probably damaging	Het
Myoz2	C	T	3: 123,026,127	R61H	probably damaging	Het
Ncdn	G	A	4: 126,752,003	R38C	probably damaging	Het
Nckap1	T	A	2: 80,520,556	T736S	probably benign	Het
Ncor2	G	A	5: 125,019,890	A2325V	probably damaging	Het
Nid2	T	A	14: 19,752,431	V140E	possibly damaging	Het
Nlrp9c	C	A	7: 26,380,490	D704Y	probably benign	Het
Notch3	T	A	17: 32,158,725	S126C	probably damaging	Het
Olfr1128	A	T	2: 87,544,983	L187H	probably damaging	Het
Olfr130	T	C	17: 38,067,948	I259T	probably damaging	Het
Olfr215	A	C	6: 116,582,697	F83C	probably damaging	Het
Olfr484	A	G	7: 108,124,915	F116S	probably benign	Het
Olfr804	T	C	10: 129,705,607	M243T	possibly damaging	Het
Olfr818	A	T	10: 129,945,582	L160*	probably null	Het
Pdzd7	A	G	19: 45,039,228	I269T	probably damaging	Het
Phf3	A	T	1: 30,806,206	D1299E	probably damaging	Het
Pitx2	T	A	3: 129,218,754	Y271N	probably damaging	Het
Polk	T	C	13: 96,496,632	E301G	probably damaging	Het
Prkdc	C	A	16: 15,739,524	N2230K	probably damaging	Het
Prlr	A	G	15: 10,322,536	E170G	probably benign	Het
Prss55	A	G	14: 64,075,730	I235T	probably damaging	Het
Psd3	T	C	8: 67,960,565	I724V	probably benign	Het
Rabep2	A	G	7: 126,438,799	T248A	possibly damaging	Het
Rbm26	T	A	14: 105,117,073	K949N	probably benign	Het
Rnf213	T	A	11: 119,440,221	D2085E	probably damaging	Het
Serpinb7	A	T	1: 107,450,273	H232L	possibly damaging	Het
Slu7	A	G	11: 43,445,242	Q484R	probably benign	Het
Smg1	A	G	7: 118,145,798	S3044P	possibly damaging	Het
Snrnp48	A	G	13: 38,221,360	D248G	possibly damaging	Het
Snrpc	C	A	17: 27,845,219	P66Q	unknown	Het
Snrpn	T	A	7: 59,983,459		probably benign	Het
Spag17	T	A	3: 99,939,356	S65R	possibly damaging	Het
Srsf6	C	A	2: 162,934,488		probably benign	Het
Stil	T	A	4: 115,041,782	M1203K	probably benign	Het
Syt17	T	C	7: 118,436,838	T106A	probably benign	Het
Tbx15	C	T	3: 99,352,246	Q478*	probably null	Het
Tg	A	T	15: 66,737,548	Q319L	probably benign	Het
Thada	A	G	17: 84,448,033	L243P	probably damaging	Het
Thada	G	T	17: 84,448,034	L243I	probably damaging	Het
Tnnt3	A	G	7: 142,512,364	R211G	probably damaging	Het
Togaram1	A	T	12: 65,002,635	Q1282L	possibly damaging	Het
Tpm3-rs7	T	G	14: 113,314,947	M91R	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Ttll7	T	G	3: 146,915,780	L378R	probably damaging	Het
Tyw1	T	G	5: 130,258,993	I22R	probably damaging	Het
Ubr3	T	C	2: 70,016,367	S1645P	possibly damaging	Het
Ubr4	T	C	4: 139,393,053	L263P	probably damaging	Het
Unc13c	T	C	9: 73,756,339	E1071G	possibly damaging	Het
Vmn2r44	G	T	7: 8,380,123	D157E	possibly damaging	Het
Vps16	C	T	2: 130,443,600	T821I	probably benign	Het
Washc4	T	C	10: 83,579,525	V793A	possibly damaging	Het
Wdr35	G	T	12: 8,977,435		probably null	Het
Zfp277	A	G	12: 40,364,085	F254L	probably benign	Het

Other mutations in Myo7a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Myo7a	APN	7	98102626	missense	probably damaging	1.00
IGL00785:Myo7a	APN	7	98054348	missense	probably damaging	0.99
IGL00840:Myo7a	APN	7	98051659	missense	probably benign	0.25
IGL01362:Myo7a	APN	7	98097702	missense	probably damaging	1.00
IGL01484:Myo7a	APN	7	98085422	missense	probably damaging	1.00
IGL01673:Myo7a	APN	7	98054708	missense	probably benign	0.00
IGL01933:Myo7a	APN	7	98083142	missense	probably damaging	1.00
IGL01943:Myo7a	APN	7	98065647	missense	possibly damaging	0.96
IGL02188:Myo7a	APN	7	98091027	missense	probably damaging	0.96
IGL02304:Myo7a	APN	7	98077736	missense	possibly damaging	0.89
IGL02305:Myo7a	APN	7	98051629	makesense	probably null
IGL02331:Myo7a	APN	7	98053182	missense	possibly damaging	0.95
IGL02386:Myo7a	APN	7	98075112	missense	probably damaging	0.99
IGL02389:Myo7a	APN	7	98106991	critical splice donor site	probably null
IGL02832:Myo7a	APN	7	98091020	critical splice donor site	probably null
IGL02839:Myo7a	APN	7	98091122	missense	probably damaging	1.00
IGL03193:Myo7a	APN	7	98091057	missense	probably damaging	1.00
IGL03237:Myo7a	APN	7	98102593	missense	probably damaging	1.00
IGL03384:Myo7a	APN	7	98093593	missense	probably damaging	1.00
coward	UTSW	7	98085466	missense	probably damaging	1.00
H8786:Myo7a	UTSW	7	98095778	missense	possibly damaging	0.61
IGL03046:Myo7a	UTSW	7	98079327	missense	probably damaging	1.00
IGL03134:Myo7a	UTSW	7	98056767	missense	probably damaging	0.96
PIT4696001:Myo7a	UTSW	7	98063599	missense	probably benign	0.00
R0054:Myo7a	UTSW	7	98065698	missense	probably damaging	1.00
R0054:Myo7a	UTSW	7	98065698	missense	probably damaging	1.00
R0071:Myo7a	UTSW	7	98056830	missense	probably damaging	0.98
R0071:Myo7a	UTSW	7	98056830	missense	probably damaging	0.98
R0267:Myo7a	UTSW	7	98054624	missense	probably benign	0.08
R0408:Myo7a	UTSW	7	98056781	missense	probably damaging	1.00
R0411:Myo7a	UTSW	7	98071937	missense	probably benign	0.00
R0540:Myo7a	UTSW	7	98071946	missense	probably damaging	1.00
R0607:Myo7a	UTSW	7	98071946	missense	probably damaging	1.00
R0629:Myo7a	UTSW	7	98085466	missense	probably damaging	1.00
R0632:Myo7a	UTSW	7	98112150	intron	probably benign
R0659:Myo7a	UTSW	7	98054338	splice site	probably benign
R0735:Myo7a	UTSW	7	98081180	splice site	probably benign
R0924:Myo7a	UTSW	7	98098256	missense	probably damaging	0.99
R0930:Myo7a	UTSW	7	98098256	missense	probably damaging	0.99
R1018:Myo7a	UTSW	7	98107005	missense	probably damaging	1.00
R1196:Myo7a	UTSW	7	98097673	missense	possibly damaging	0.87
R1331:Myo7a	UTSW	7	98107008	missense	probably benign	0.00
R1487:Myo7a	UTSW	7	98053810	critical splice donor site	probably null
R1676:Myo7a	UTSW	7	98099472	critical splice donor site	probably null
R1695:Myo7a	UTSW	7	98092496	missense	possibly damaging	0.94
R1770:Myo7a	UTSW	7	98112606	intron	probably benign
R1781:Myo7a	UTSW	7	98073124	missense	probably damaging	1.00
R1827:Myo7a	UTSW	7	98076731	missense	probably damaging	0.99
R1864:Myo7a	UTSW	7	98052256	missense	probably damaging	1.00
R1955:Myo7a	UTSW	7	98054921	missense	probably damaging	1.00
R2011:Myo7a	UTSW	7	98054708	missense	possibly damaging	0.69
R2229:Myo7a	UTSW	7	98054910	missense	probably benign	0.12
R2259:Myo7a	UTSW	7	98069499	missense	probably damaging	1.00
R2443:Myo7a	UTSW	7	98095769	missense	probably benign	0.07
R2898:Myo7a	UTSW	7	98054424	nonsense	probably null
R2898:Myo7a	UTSW	7	98097206	missense	probably damaging	1.00
R3158:Myo7a	UTSW	7	98052292	missense	probably damaging	1.00
R3408:Myo7a	UTSW	7	98081087	missense	probably benign	0.00
R4222:Myo7a	UTSW	7	98073229	missense	possibly damaging	0.93
R4255:Myo7a	UTSW	7	98071964	missense	probably damaging	0.96
R4374:Myo7a	UTSW	7	98102674	missense	probably damaging	1.00
R4429:Myo7a	UTSW	7	98053188	missense	probably damaging	0.99
R4445:Myo7a	UTSW	7	98066404	missense	probably damaging	1.00
R4579:Myo7a	UTSW	7	98073193	missense	probably damaging	1.00
R4659:Myo7a	UTSW	7	98085466	missense	probably damaging	1.00
R5073:Myo7a	UTSW	7	98073218	nonsense	probably null
R5138:Myo7a	UTSW	7	98083599	missense	probably damaging	1.00
R5566:Myo7a	UTSW	7	98064816	missense	possibly damaging	0.93
R5580:Myo7a	UTSW	7	98073160	missense	probably damaging	1.00
R6079:Myo7a	UTSW	7	98065790	nonsense	probably null
R6138:Myo7a	UTSW	7	98065790	nonsense	probably null
R6451:Myo7a	UTSW	7	98073167	missense	probably benign	0.01
R6452:Myo7a	UTSW	7	98073167	missense	probably benign	0.01
R6453:Myo7a	UTSW	7	98073167	missense	probably benign	0.01
R6454:Myo7a	UTSW	7	98073167	missense	probably benign	0.01
R6455:Myo7a	UTSW	7	98073167	missense	probably benign	0.01
R6465:Myo7a	UTSW	7	98062680	missense	possibly damaging	0.95
R6653:Myo7a	UTSW	7	98054503	missense	probably damaging	0.96
R6709:Myo7a	UTSW	7	98054699	missense	probably damaging	1.00
R6917:Myo7a	UTSW	7	98095763	missense	possibly damaging	0.58
R7313:Myo7a	UTSW	7	98064195	missense	probably damaging	0.99
R7334:Myo7a	UTSW	7	98079366	missense	probably benign
R7356:Myo7a	UTSW	7	98102683	missense	probably benign	0.01
R7393:Myo7a	UTSW	7	98063699	missense	possibly damaging	0.91
R7422:Myo7a	UTSW	7	98051626	splice site	probably null
R7472:Myo7a	UTSW	7	98064793	missense	probably damaging	1.00
R7483:Myo7a	UTSW	7	98063674	missense	probably benign	0.07
R7526:Myo7a	UTSW	7	98085448	missense	possibly damaging	0.49
R7948:Myo7a	UTSW	7	98075029	missense	probably damaging	1.00
R8069:Myo7a	UTSW	7	98083626	nonsense	probably null
RF005:Myo7a	UTSW	7	98093617	missense	probably benign	0.42
U15987:Myo7a	UTSW	7	98065790	nonsense	probably null
X0028:Myo7a	UTSW	7	98065725	missense	probably damaging	1.00
X0058:Myo7a	UTSW	7	98062648	missense	probably benign	0.02
Z1176:Myo7a	UTSW	7	98095727	missense	probably damaging	0.98
Z1177:Myo7a	UTSW	7	98052226	missense	probably damaging	0.98
Z1177:Myo7a	UTSW	7	98085523	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGTCACTTCCTACTCTAGACAC -3'
(R):5'- TGGCTGCTCCTCTTCATGAG -3'

Sequencing Primer
(F):5'- TAGACACCTGCCATTGTAGC -3'
(R):5'- TCGGCTCACTCACCTGG -3'

Posted On

2014-06-23