Mutagenetix > Incidental Mutation

Incidental Mutation 'R1789:Arhgef17'

201618

Institutional Source

Beutler Lab

Gene Symbol

Arhgef17

Ensembl Gene

ENSMUSG00000032875

Gene Name

Rho guanine nucleotide exchange factor (GEF) 17

Synonyms

MMRRC Submission

039820-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1789 (G1)

Quality Score

197

Status

Not validated

Chromosome

Chromosomal Location

100869752-100932107 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100929870 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 624 (S624P)

Ref Sequence

ENSEMBL: ENSMUSP00000102647 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107032]

AlphaFold

Q80U35

Predicted Effect

probably damaging
Transcript: ENSMUST00000107032
AA Change: S624P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102647
Gene: ENSMUSG00000032875
AA Change: S624P

Domain	Start	End	E-Value	Type
low complexity region	65	74	N/A	INTRINSIC
low complexity region	160	175	N/A	INTRINSIC
low complexity region	196	209	N/A	INTRINSIC
low complexity region	227	255	N/A	INTRINSIC
low complexity region	282	297	N/A	INTRINSIC
low complexity region	314	323	N/A	INTRINSIC
low complexity region	507	526	N/A	INTRINSIC
low complexity region	559	572	N/A	INTRINSIC
low complexity region	828	842	N/A	INTRINSIC
low complexity region	970	984	N/A	INTRINSIC
RhoGEF	1063	1246	9.56e-61	SMART
Blast:PH	1281	1466	4e-88	BLAST
low complexity region	1582	1595	N/A	INTRINSIC
low complexity region	1630	1642	N/A	INTRINSIC
low complexity region	1646	1657	N/A	INTRINSIC
low complexity region	1661	1701	N/A	INTRINSIC
low complexity region	1708	1719	N/A	INTRINSIC
low complexity region	2033	2040	N/A	INTRINSIC

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	G	A	16: 20,365,951	P986L	probably damaging	Het
Acad10	A	T	5: 121,631,393	Y667N	possibly damaging	Het
Ahi1	G	A	10: 20,963,115	G121D	probably benign	Het
Ampd1	T	A	3: 103,099,126	I690N	possibly damaging	Het
Amy1	C	A	3: 113,558,165	W425L	possibly damaging	Het
Arhgap27	A	T	11: 103,333,005	V823E	probably damaging	Het
Arid5b	T	C	10: 68,186,067	H231R	probably damaging	Het
Aspscr1	C	A	11: 120,688,560	T78N	probably damaging	Het
Auts2	T	A	5: 131,472,450	T42S	probably damaging	Het
Ccdc171	A	G	4: 83,554,808	D158G	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap61	T	C	2: 145,939,993		probably null	Het
Chrna5	T	C	9: 55,004,651	V245A	possibly damaging	Het
Cntnap5c	G	A	17: 58,013,921	G163R	probably damaging	Het
Col5a2	A	G	1: 45,378,305		probably null	Het
Col5a2	T	C	1: 45,394,776	Q759R	probably damaging	Het
Comp	A	G	8: 70,377,146	D340G	probably benign	Het
Cyfip1	T	A	7: 55,926,395	D1104E	probably damaging	Het
Dnah11	A	T	12: 118,038,780	S308T	probably damaging	Het
Dnah5	A	G	15: 28,270,426	H958R	probably benign	Het
Elp3	A	G	14: 65,547,919	Y478H	probably damaging	Het
Fat3	T	C	9: 16,376,985	Y414C	probably benign	Het
Fbxo10	C	A	4: 45,046,389	A574S	probably damaging	Het
Fsip2	G	T	2: 82,977,562	L1408F	probably benign	Het
Fubp3	T	C	2: 31,611,735	V425A	possibly damaging	Het
Gm7168	A	T	17: 13,949,584	R404S	probably benign	Het
Gm8773	A	T	5: 5,575,652	Q116L	possibly damaging	Het
Gpd1	T	G	15: 99,723,202	F299C	probably damaging	Het
Gpr137	C	T	19: 6,942,057		probably benign	Het
Grin3b	T	C	10: 79,973,408	S331P	probably benign	Het
Grk3	T	A	5: 112,941,718	I281F	probably damaging	Het
Hoxb7	T	A	11: 96,286,781	S18R	probably damaging	Het
Igf1r	C	T	7: 68,214,933	R1160*	probably null	Het
Itfg1	A	G	8: 85,725,512		probably null	Het
Itgb8	T	C	12: 119,202,455	I114V	probably benign	Het
Kcnk1	A	G	8: 126,025,384	E243G	possibly damaging	Het
Kif27	A	G	13: 58,344,008	L439P	probably damaging	Het
Kif2c	T	A	4: 117,167,361	Q279L	probably benign	Het
Kmt2d	A	T	15: 98,852,074		probably benign	Het
L3mbtl1	A	G	2: 162,974,502	T821A	probably benign	Het
Lrrc24	A	T	15: 76,722,578	M206K	probably benign	Het
Mamdc4	T	G	2: 25,567,622	K460Q	possibly damaging	Het
Maml2	C	G	9: 13,697,345	L30V	probably damaging	Het
Mc5r	C	G	18: 68,338,670		probably null	Het
Myo10	T	G	15: 25,726,525		probably null	Het
Myo1e	T	A	9: 70,338,784	L419Q	probably damaging	Het
Myo6	C	A	9: 80,300,572	H1115Q	probably damaging	Het
Myo7a	A	G	7: 98,107,095	V10A	probably damaging	Het
Myoz2	C	T	3: 123,026,127	R61H	probably damaging	Het
Ncdn	G	A	4: 126,752,003	R38C	probably damaging	Het
Nckap1	T	A	2: 80,520,556	T736S	probably benign	Het
Ncor2	G	A	5: 125,019,890	A2325V	probably damaging	Het
Nid2	T	A	14: 19,752,431	V140E	possibly damaging	Het
Nlrp9c	C	A	7: 26,380,490	D704Y	probably benign	Het
Notch3	T	A	17: 32,158,725	S126C	probably damaging	Het
Olfr1128	A	T	2: 87,544,983	L187H	probably damaging	Het
Olfr130	T	C	17: 38,067,948	I259T	probably damaging	Het
Olfr215	A	C	6: 116,582,697	F83C	probably damaging	Het
Olfr484	A	G	7: 108,124,915	F116S	probably benign	Het
Olfr804	T	C	10: 129,705,607	M243T	possibly damaging	Het
Olfr818	A	T	10: 129,945,582	L160*	probably null	Het
Pdzd7	A	G	19: 45,039,228	I269T	probably damaging	Het
Phf3	A	T	1: 30,806,206	D1299E	probably damaging	Het
Pitx2	T	A	3: 129,218,754	Y271N	probably damaging	Het
Polk	T	C	13: 96,496,632	E301G	probably damaging	Het
Prkdc	C	A	16: 15,739,524	N2230K	probably damaging	Het
Prlr	A	G	15: 10,322,536	E170G	probably benign	Het
Prss55	A	G	14: 64,075,730	I235T	probably damaging	Het
Psd3	T	C	8: 67,960,565	I724V	probably benign	Het
Rabep2	A	G	7: 126,438,799	T248A	possibly damaging	Het
Rbm26	T	A	14: 105,117,073	K949N	probably benign	Het
Rnf213	T	A	11: 119,440,221	D2085E	probably damaging	Het
Serpinb7	A	T	1: 107,450,273	H232L	possibly damaging	Het
Slu7	A	G	11: 43,445,242	Q484R	probably benign	Het
Smg1	A	G	7: 118,145,798	S3044P	possibly damaging	Het
Snrnp48	A	G	13: 38,221,360	D248G	possibly damaging	Het
Snrpc	C	A	17: 27,845,219	P66Q	unknown	Het
Snrpn	T	A	7: 59,983,459		probably benign	Het
Spag17	T	A	3: 99,939,356	S65R	possibly damaging	Het
Srsf6	C	A	2: 162,934,488		probably benign	Het
Stil	T	A	4: 115,041,782	M1203K	probably benign	Het
Syt17	T	C	7: 118,436,838	T106A	probably benign	Het
Tbx15	C	T	3: 99,352,246	Q478*	probably null	Het
Tg	A	T	15: 66,737,548	Q319L	probably benign	Het
Thada	A	G	17: 84,448,033	L243P	probably damaging	Het
Thada	G	T	17: 84,448,034	L243I	probably damaging	Het
Tnnt3	A	G	7: 142,512,364	R211G	probably damaging	Het
Togaram1	A	T	12: 65,002,635	Q1282L	possibly damaging	Het
Tpm3-rs7	T	G	14: 113,314,947	M91R	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Ttll7	T	G	3: 146,915,780	L378R	probably damaging	Het
Tyw1	T	G	5: 130,258,993	I22R	probably damaging	Het
Ubr3	T	C	2: 70,016,367	S1645P	possibly damaging	Het
Ubr4	T	C	4: 139,393,053	L263P	probably damaging	Het
Unc13c	T	C	9: 73,756,339	E1071G	possibly damaging	Het
Vmn2r44	G	T	7: 8,380,123	D157E	possibly damaging	Het
Vps16	C	T	2: 130,443,600	T821I	probably benign	Het
Washc4	T	C	10: 83,579,525	V793A	possibly damaging	Het
Wdr35	G	T	12: 8,977,435		probably null	Het
Zfp277	A	G	12: 40,364,085	F254L	probably benign	Het

Other mutations in Arhgef17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00844:Arhgef17	APN	7	100929449	missense	probably benign
IGL01071:Arhgef17	APN	7	100885700	missense	probably damaging	0.99
IGL01882:Arhgef17	APN	7	100878580	nonsense	probably null
IGL01995:Arhgef17	APN	7	100928655	missense	probably benign	0.02
IGL02213:Arhgef17	APN	7	100890426	missense	probably benign
IGL02380:Arhgef17	APN	7	100929443	missense	possibly damaging	0.60
IGL02551:Arhgef17	APN	7	100930346	missense	probably damaging	1.00
IGL02613:Arhgef17	APN	7	100928896	missense	probably damaging	1.00
IGL02643:Arhgef17	APN	7	100883882	missense	possibly damaging	0.95
IGL02798:Arhgef17	APN	7	100929626	missense	probably benign	0.00
IGL03113:Arhgef17	APN	7	100929731	missense	probably benign	0.00
IGL03264:Arhgef17	APN	7	100880013	missense	probably benign	0.00
G1Funyon:Arhgef17	UTSW	7	100879659	missense	probably benign	0.00
R0064:Arhgef17	UTSW	7	100881354	missense	probably benign	0.00
R0189:Arhgef17	UTSW	7	100928850	missense	probably damaging	1.00
R0482:Arhgef17	UTSW	7	100880621	missense	probably damaging	1.00
R0826:Arhgef17	UTSW	7	100930743	missense	probably benign	0.01
R1295:Arhgef17	UTSW	7	100881269	nonsense	probably null
R1296:Arhgef17	UTSW	7	100881269	nonsense	probably null
R1389:Arhgef17	UTSW	7	100931037	small deletion	probably benign
R1466:Arhgef17	UTSW	7	100929659	missense	possibly damaging	0.48
R1466:Arhgef17	UTSW	7	100929659	missense	possibly damaging	0.48
R1513:Arhgef17	UTSW	7	100930862	missense	probably benign
R1539:Arhgef17	UTSW	7	100890473	missense	probably damaging	1.00
R1644:Arhgef17	UTSW	7	100929504	missense	probably damaging	1.00
R1861:Arhgef17	UTSW	7	100882268	missense	probably damaging	1.00
R1868:Arhgef17	UTSW	7	100878977	missense	probably benign
R2009:Arhgef17	UTSW	7	100881781	missense	probably damaging	0.98
R2095:Arhgef17	UTSW	7	100881263	missense	probably damaging	1.00
R2311:Arhgef17	UTSW	7	100928904	missense	probably benign	0.35
R3607:Arhgef17	UTSW	7	100931172	missense	probably damaging	1.00
R3882:Arhgef17	UTSW	7	100876454	missense	possibly damaging	0.70
R4089:Arhgef17	UTSW	7	100883799	missense	probably damaging	1.00
R4420:Arhgef17	UTSW	7	100882308	splice site	probably benign
R4536:Arhgef17	UTSW	7	100929854	missense	probably damaging	1.00
R4548:Arhgef17	UTSW	7	100931129	missense	possibly damaging	0.60
R4616:Arhgef17	UTSW	7	100882485	missense	probably damaging	1.00
R5040:Arhgef17	UTSW	7	100876825	missense	probably benign	0.17
R5100:Arhgef17	UTSW	7	100881756	missense	possibly damaging	0.90
R5233:Arhgef17	UTSW	7	100881369	missense	possibly damaging	0.61
R5307:Arhgef17	UTSW	7	100929428	missense	probably benign	0.00
R5313:Arhgef17	UTSW	7	100928924	missense	probably damaging	0.99
R5643:Arhgef17	UTSW	7	100880011	missense	probably damaging	1.00
R5704:Arhgef17	UTSW	7	100881341	missense	probably damaging	1.00
R6166:Arhgef17	UTSW	7	100876492	missense	probably damaging	1.00
R6417:Arhgef17	UTSW	7	100930062	missense	probably damaging	1.00
R6420:Arhgef17	UTSW	7	100930062	missense	probably damaging	1.00
R6510:Arhgef17	UTSW	7	100878536	missense	probably damaging	0.97
R6877:Arhgef17	UTSW	7	100881341	missense	probably damaging	1.00
R6888:Arhgef17	UTSW	7	100930820	missense	possibly damaging	0.74
R7016:Arhgef17	UTSW	7	100878977	missense	probably benign
R7073:Arhgef17	UTSW	7	100929991	nonsense	probably null
R7322:Arhgef17	UTSW	7	100877797	missense	probably benign	0.01
R7691:Arhgef17	UTSW	7	100929642	missense	probably damaging	1.00
R7724:Arhgef17	UTSW	7	100880609	missense	probably damaging	1.00
R7728:Arhgef17	UTSW	7	100930068	missense	probably benign	0.00
R7829:Arhgef17	UTSW	7	100876845	missense	probably benign	0.03
R8036:Arhgef17	UTSW	7	100929855	missense	probably damaging	1.00
R8072:Arhgef17	UTSW	7	100881797	missense	probably benign	0.04
R8301:Arhgef17	UTSW	7	100879659	missense	probably benign	0.00
R8935:Arhgef17	UTSW	7	100878117	missense	probably benign	0.03
R8958:Arhgef17	UTSW	7	100929812	missense	probably damaging	0.98
R9221:Arhgef17	UTSW	7	100879611	missense	possibly damaging	0.78
R9362:Arhgef17	UTSW	7	100930958	missense	probably benign	0.12
R9499:Arhgef17	UTSW	7	100876895	missense	possibly damaging	0.52
R9593:Arhgef17	UTSW	7	100882802	missense	probably damaging	1.00
X0012:Arhgef17	UTSW	7	100928904	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- GAAGGTGGCACTTTTCGTCTCC -3'
(R):5'- TGAAGCCTAGCTCCTCAGAG -3'

Sequencing Primer
(F):5'- TCTCAGGAGACACAAGGGCC -3'
(R):5'- AGAGCTCCTACTGGCAGGTTC -3'

Posted On

2014-06-23