Incidental Mutation 'R1789:Rabep2'
ID 201622
Institutional Source Beutler Lab
Gene Symbol Rabep2
Ensembl Gene ENSMUSG00000030727
Gene Name rabaptin, RAB GTPase binding effector protein 2
Synonyms
MMRRC Submission 039820-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock # R1789 (G1)
Quality Score 163
Status Not validated
Chromosome 7
Chromosomal Location 126428759-126449245 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 126438799 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 248 (T248A)
Ref Sequence ENSEMBL: ENSMUSP00000102015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106405] [ENSMUST00000106407] [ENSMUST00000150530] [ENSMUST00000150933]
AlphaFold Q91WG2
Predicted Effect possibly damaging
Transcript: ENSMUST00000106405
AA Change: T205A

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102013
Gene: ENSMUSG00000030727
AA Change: T205A

DomainStartEndE-ValueType
Pfam:Rabaptin 2 107 1.4e-41 PFAM
low complexity region 139 158 N/A INTRINSIC
low complexity region 175 194 N/A INTRINSIC
Pfam:Rabaptin 196 311 5.9e-10 PFAM
Pfam:Rab5-bind 289 456 4.6e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106407
AA Change: T248A

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102015
Gene: ENSMUSG00000030727
AA Change: T248A

DomainStartEndE-ValueType
Pfam:Rabaptin 13 171 1.4e-39 PFAM
low complexity region 182 201 N/A INTRINSIC
low complexity region 218 237 N/A INTRINSIC
Pfam:Rab5-bind 274 487 4.1e-21 PFAM
Pfam:Rab5-bind 469 531 1.6e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148536
Predicted Effect probably benign
Transcript: ENSMUST00000150530
SMART Domains Protein: ENSMUSP00000122141
Gene: ENSMUSG00000030727

DomainStartEndE-ValueType
Pfam:Rabaptin 5 54 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150933
SMART Domains Protein: ENSMUSP00000123559
Gene: ENSMUSG00000030727

DomainStartEndE-ValueType
Pfam:Rabaptin 2 91 2e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151304
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G A 16: 20,365,951 P986L probably damaging Het
Acad10 A T 5: 121,631,393 Y667N possibly damaging Het
Ahi1 G A 10: 20,963,115 G121D probably benign Het
Ampd1 T A 3: 103,099,126 I690N possibly damaging Het
Amy1 C A 3: 113,558,165 W425L possibly damaging Het
Arhgap27 A T 11: 103,333,005 V823E probably damaging Het
Arhgef17 A G 7: 100,929,870 S624P probably damaging Het
Arid5b T C 10: 68,186,067 H231R probably damaging Het
Aspscr1 C A 11: 120,688,560 T78N probably damaging Het
Auts2 T A 5: 131,472,450 T42S probably damaging Het
Ccdc171 A G 4: 83,554,808 D158G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap61 T C 2: 145,939,993 probably null Het
Chrna5 T C 9: 55,004,651 V245A possibly damaging Het
Cntnap5c G A 17: 58,013,921 G163R probably damaging Het
Col5a2 A G 1: 45,378,305 probably null Het
Col5a2 T C 1: 45,394,776 Q759R probably damaging Het
Comp A G 8: 70,377,146 D340G probably benign Het
Cyfip1 T A 7: 55,926,395 D1104E probably damaging Het
Dnah11 A T 12: 118,038,780 S308T probably damaging Het
Dnah5 A G 15: 28,270,426 H958R probably benign Het
Elp3 A G 14: 65,547,919 Y478H probably damaging Het
Fat3 T C 9: 16,376,985 Y414C probably benign Het
Fbxo10 C A 4: 45,046,389 A574S probably damaging Het
Fsip2 G T 2: 82,977,562 L1408F probably benign Het
Fubp3 T C 2: 31,611,735 V425A possibly damaging Het
Gm7168 A T 17: 13,949,584 R404S probably benign Het
Gm8773 A T 5: 5,575,652 Q116L possibly damaging Het
Gpd1 T G 15: 99,723,202 F299C probably damaging Het
Gpr137 C T 19: 6,942,057 probably benign Het
Grin3b T C 10: 79,973,408 S331P probably benign Het
Grk3 T A 5: 112,941,718 I281F probably damaging Het
Hoxb7 T A 11: 96,286,781 S18R probably damaging Het
Igf1r C T 7: 68,214,933 R1160* probably null Het
Itfg1 A G 8: 85,725,512 probably null Het
Itgb8 T C 12: 119,202,455 I114V probably benign Het
Kcnk1 A G 8: 126,025,384 E243G possibly damaging Het
Kif27 A G 13: 58,344,008 L439P probably damaging Het
Kif2c T A 4: 117,167,361 Q279L probably benign Het
Kmt2d A T 15: 98,852,074 probably benign Het
L3mbtl1 A G 2: 162,974,502 T821A probably benign Het
Lrrc24 A T 15: 76,722,578 M206K probably benign Het
Mamdc4 T G 2: 25,567,622 K460Q possibly damaging Het
Maml2 C G 9: 13,697,345 L30V probably damaging Het
Mc5r C G 18: 68,338,670 probably null Het
Myo10 T G 15: 25,726,525 probably null Het
Myo1e T A 9: 70,338,784 L419Q probably damaging Het
Myo6 C A 9: 80,300,572 H1115Q probably damaging Het
Myo7a A G 7: 98,107,095 V10A probably damaging Het
Myoz2 C T 3: 123,026,127 R61H probably damaging Het
Ncdn G A 4: 126,752,003 R38C probably damaging Het
Nckap1 T A 2: 80,520,556 T736S probably benign Het
Ncor2 G A 5: 125,019,890 A2325V probably damaging Het
Nid2 T A 14: 19,752,431 V140E possibly damaging Het
Nlrp9c C A 7: 26,380,490 D704Y probably benign Het
Notch3 T A 17: 32,158,725 S126C probably damaging Het
Olfr1128 A T 2: 87,544,983 L187H probably damaging Het
Olfr130 T C 17: 38,067,948 I259T probably damaging Het
Olfr215 A C 6: 116,582,697 F83C probably damaging Het
Olfr484 A G 7: 108,124,915 F116S probably benign Het
Olfr804 T C 10: 129,705,607 M243T possibly damaging Het
Olfr818 A T 10: 129,945,582 L160* probably null Het
Pdzd7 A G 19: 45,039,228 I269T probably damaging Het
Phf3 A T 1: 30,806,206 D1299E probably damaging Het
Pitx2 T A 3: 129,218,754 Y271N probably damaging Het
Polk T C 13: 96,496,632 E301G probably damaging Het
Prkdc C A 16: 15,739,524 N2230K probably damaging Het
Prlr A G 15: 10,322,536 E170G probably benign Het
Prss55 A G 14: 64,075,730 I235T probably damaging Het
Psd3 T C 8: 67,960,565 I724V probably benign Het
Rbm26 T A 14: 105,117,073 K949N probably benign Het
Rnf213 T A 11: 119,440,221 D2085E probably damaging Het
Serpinb7 A T 1: 107,450,273 H232L possibly damaging Het
Slu7 A G 11: 43,445,242 Q484R probably benign Het
Smg1 A G 7: 118,145,798 S3044P possibly damaging Het
Snrnp48 A G 13: 38,221,360 D248G possibly damaging Het
Snrpc C A 17: 27,845,219 P66Q unknown Het
Snrpn T A 7: 59,983,459 probably benign Het
Spag17 T A 3: 99,939,356 S65R possibly damaging Het
Srsf6 C A 2: 162,934,488 probably benign Het
Stil T A 4: 115,041,782 M1203K probably benign Het
Syt17 T C 7: 118,436,838 T106A probably benign Het
Tbx15 C T 3: 99,352,246 Q478* probably null Het
Tg A T 15: 66,737,548 Q319L probably benign Het
Thada A G 17: 84,448,033 L243P probably damaging Het
Thada G T 17: 84,448,034 L243I probably damaging Het
Tnnt3 A G 7: 142,512,364 R211G probably damaging Het
Togaram1 A T 12: 65,002,635 Q1282L possibly damaging Het
Tpm3-rs7 T G 14: 113,314,947 M91R probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Ttll7 T G 3: 146,915,780 L378R probably damaging Het
Tyw1 T G 5: 130,258,993 I22R probably damaging Het
Ubr3 T C 2: 70,016,367 S1645P possibly damaging Het
Ubr4 T C 4: 139,393,053 L263P probably damaging Het
Unc13c T C 9: 73,756,339 E1071G possibly damaging Het
Vmn2r44 G T 7: 8,380,123 D157E possibly damaging Het
Vps16 C T 2: 130,443,600 T821I probably benign Het
Washc4 T C 10: 83,579,525 V793A possibly damaging Het
Wdr35 G T 12: 8,977,435 probably null Het
Zfp277 A G 12: 40,364,085 F254L probably benign Het
Other mutations in Rabep2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02203:Rabep2 APN 7 126440394 missense possibly damaging 0.56
R0799:Rabep2 UTSW 7 126438724 missense probably damaging 1.00
R1219:Rabep2 UTSW 7 126429627 missense probably damaging 1.00
R1731:Rabep2 UTSW 7 126444272 missense probably damaging 1.00
R1735:Rabep2 UTSW 7 126444540 missense probably damaging 1.00
R1951:Rabep2 UTSW 7 126438564 missense possibly damaging 0.67
R2113:Rabep2 UTSW 7 126445288 splice site probably null
R4008:Rabep2 UTSW 7 126445374 missense probably damaging 1.00
R4357:Rabep2 UTSW 7 126448225 missense probably damaging 1.00
R4915:Rabep2 UTSW 7 126444922 missense probably damaging 1.00
R5176:Rabep2 UTSW 7 126434293 intron probably benign
R5512:Rabep2 UTSW 7 126438799 missense possibly damaging 0.76
R6729:Rabep2 UTSW 7 126440197 missense probably benign 0.00
R7055:Rabep2 UTSW 7 126445313 missense possibly damaging 0.94
R7288:Rabep2 UTSW 7 126444205 missense probably damaging 1.00
R7419:Rabep2 UTSW 7 126444170 missense probably benign 0.07
R7426:Rabep2 UTSW 7 126438719 missense probably damaging 1.00
R7477:Rabep2 UTSW 7 126444818 critical splice acceptor site probably null
R7801:Rabep2 UTSW 7 126438412 missense possibly damaging 0.66
R7823:Rabep2 UTSW 7 126438721 missense probably damaging 1.00
R8245:Rabep2 UTSW 7 126440408 missense possibly damaging 0.93
R8265:Rabep2 UTSW 7 126444251 missense probably benign 0.01
R8476:Rabep2 UTSW 7 126435743 nonsense probably null
R8679:Rabep2 UTSW 7 126435676 nonsense probably null
R9022:Rabep2 UTSW 7 126444547 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAATCCTCCCTAGAGACGAC -3'
(R):5'- GCAAGCCCACATATATCCAGGG -3'

Sequencing Primer
(F):5'- ATGGCTCCACAGAGTTGCTC -3'
(R):5'- TATATCCAGGGAGACAGGAATGTTC -3'
Posted On 2014-06-23