Incidental Mutation 'R1789:Ces4a'
ID201627
Institutional Source Beutler Lab
Gene Symbol Ces4a
Ensembl Gene ENSMUSG00000060560
Gene Namecarboxylesterase 4A
SynonymsCes8
MMRRC Submission 039820-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1789 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105131800-105150109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105138097 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 69 (G69S)
Ref Sequence ENSEMBL: ENSMUSP00000125062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161289]
Predicted Effect probably damaging
Transcript: ENSMUST00000161289
AA Change: G69S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125062
Gene: ENSMUSG00000060560
AA Change: G69S

DomainStartEndE-ValueType
Pfam:COesterase 8 554 4.9e-163 PFAM
Pfam:Abhydrolase_3 143 319 2e-9 PFAM
Meta Mutation Damage Score 0.7473 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They also participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This gene, also called CES6, encodes a secreted enzyme, and may play a role in the detoxification of drugs and xenobiotics in neural and other tissues of the body and in the cerebrospinal fluid. Multiple transcript variants encoding different isoforms have been reported, but the full-length nature and/or biological validity of some variants have not been determined. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G A 16: 20,365,951 P986L probably damaging Het
Acad10 A T 5: 121,631,393 Y667N possibly damaging Het
Ahi1 G A 10: 20,963,115 G121D probably benign Het
Ampd1 T A 3: 103,099,126 I690N possibly damaging Het
Amy1 C A 3: 113,558,165 W425L possibly damaging Het
Arhgap27 A T 11: 103,333,005 V823E probably damaging Het
Arhgef17 A G 7: 100,929,870 S624P probably damaging Het
Arid5b T C 10: 68,186,067 H231R probably damaging Het
Aspscr1 C A 11: 120,688,560 T78N probably damaging Het
Auts2 T A 5: 131,472,450 T42S probably damaging Het
Ccdc171 A G 4: 83,554,808 D158G probably damaging Het
Cfap61 T C 2: 145,939,993 probably null Het
Chrna5 T C 9: 55,004,651 V245A possibly damaging Het
Cntnap5c G A 17: 58,013,921 G163R probably damaging Het
Col5a2 A G 1: 45,378,305 probably null Het
Col5a2 T C 1: 45,394,776 Q759R probably damaging Het
Comp A G 8: 70,377,146 D340G probably benign Het
Cyfip1 T A 7: 55,926,395 D1104E probably damaging Het
Dnah11 A T 12: 118,038,780 S308T probably damaging Het
Dnah5 A G 15: 28,270,426 H958R probably benign Het
Elp3 A G 14: 65,547,919 Y478H probably damaging Het
Fat3 T C 9: 16,376,985 Y414C probably benign Het
Fbxo10 C A 4: 45,046,389 A574S probably damaging Het
Fsip2 G T 2: 82,977,562 L1408F probably benign Het
Fubp3 T C 2: 31,611,735 V425A possibly damaging Het
Gm7168 A T 17: 13,949,584 R404S probably benign Het
Gm8773 A T 5: 5,575,652 Q116L possibly damaging Het
Gpd1 T G 15: 99,723,202 F299C probably damaging Het
Gpr137 C T 19: 6,942,057 probably benign Het
Grin3b T C 10: 79,973,408 S331P probably benign Het
Grk3 T A 5: 112,941,718 I281F probably damaging Het
Hoxb7 T A 11: 96,286,781 S18R probably damaging Het
Igf1r C T 7: 68,214,933 R1160* probably null Het
Itfg1 A G 8: 85,725,512 probably null Het
Itgb8 T C 12: 119,202,455 I114V probably benign Het
Kcnk1 A G 8: 126,025,384 E243G possibly damaging Het
Kif27 A G 13: 58,344,008 L439P probably damaging Het
Kif2c T A 4: 117,167,361 Q279L probably benign Het
Kmt2d A T 15: 98,852,074 probably benign Het
L3mbtl1 A G 2: 162,974,502 T821A probably benign Het
Lrrc24 A T 15: 76,722,578 M206K probably benign Het
Mamdc4 T G 2: 25,567,622 K460Q possibly damaging Het
Maml2 C G 9: 13,697,345 L30V probably damaging Het
Mc5r C G 18: 68,338,670 probably null Het
Myo10 T G 15: 25,726,525 probably null Het
Myo1e T A 9: 70,338,784 L419Q probably damaging Het
Myo6 C A 9: 80,300,572 H1115Q probably damaging Het
Myo7a A G 7: 98,107,095 V10A probably damaging Het
Myoz2 C T 3: 123,026,127 R61H probably damaging Het
Ncdn G A 4: 126,752,003 R38C probably damaging Het
Nckap1 T A 2: 80,520,556 T736S probably benign Het
Ncor2 G A 5: 125,019,890 A2325V probably damaging Het
Nid2 T A 14: 19,752,431 V140E possibly damaging Het
Nlrp9c C A 7: 26,380,490 D704Y probably benign Het
Notch3 T A 17: 32,158,725 S126C probably damaging Het
Olfr1128 A T 2: 87,544,983 L187H probably damaging Het
Olfr130 T C 17: 38,067,948 I259T probably damaging Het
Olfr215 A C 6: 116,582,697 F83C probably damaging Het
Olfr484 A G 7: 108,124,915 F116S probably benign Het
Olfr804 T C 10: 129,705,607 M243T possibly damaging Het
Olfr818 A T 10: 129,945,582 L160* probably null Het
Pdzd7 A G 19: 45,039,228 I269T probably damaging Het
Phf3 A T 1: 30,806,206 D1299E probably damaging Het
Pitx2 T A 3: 129,218,754 Y271N probably damaging Het
Polk T C 13: 96,496,632 E301G probably damaging Het
Prkdc C A 16: 15,739,524 N2230K probably damaging Het
Prlr A G 15: 10,322,536 E170G probably benign Het
Prss55 A G 14: 64,075,730 I235T probably damaging Het
Psd3 T C 8: 67,960,565 I724V probably benign Het
Rabep2 A G 7: 126,438,799 T248A possibly damaging Het
Rbm26 T A 14: 105,117,073 K949N probably benign Het
Rnf213 T A 11: 119,440,221 D2085E probably damaging Het
Serpinb7 A T 1: 107,450,273 H232L possibly damaging Het
Slu7 A G 11: 43,445,242 Q484R probably benign Het
Smg1 A G 7: 118,145,798 S3044P possibly damaging Het
Snrnp48 A G 13: 38,221,360 D248G possibly damaging Het
Snrpc C A 17: 27,845,219 P66Q unknown Het
Snrpn T A 7: 59,983,459 probably benign Het
Spag17 T A 3: 99,939,356 S65R possibly damaging Het
Srsf6 C A 2: 162,934,488 probably benign Het
Stil T A 4: 115,041,782 M1203K probably benign Het
Syt17 T C 7: 118,436,838 T106A probably benign Het
Tbx15 C T 3: 99,352,246 Q478* probably null Het
Tg A T 15: 66,737,548 Q319L probably benign Het
Thada A G 17: 84,448,033 L243P probably damaging Het
Thada G T 17: 84,448,034 L243I probably damaging Het
Tnnt3 A G 7: 142,512,364 R211G probably damaging Het
Togaram1 A T 12: 65,002,635 Q1282L possibly damaging Het
Tpm3-rs7 T G 14: 113,314,947 M91R probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Ttll7 T G 3: 146,915,780 L378R probably damaging Het
Tyw1 T G 5: 130,258,993 I22R probably damaging Het
Ubr3 T C 2: 70,016,367 S1645P possibly damaging Het
Ubr4 T C 4: 139,393,053 L263P probably damaging Het
Unc13c T C 9: 73,756,339 E1071G possibly damaging Het
Vmn2r44 G T 7: 8,380,123 D157E possibly damaging Het
Vps16 C T 2: 130,443,600 T821I probably benign Het
Washc4 T C 10: 83,579,525 V793A possibly damaging Het
Wdr35 G T 12: 8,977,435 probably null Het
Zfp277 A G 12: 40,364,085 F254L probably benign Het
Other mutations in Ces4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Ces4a APN 8 105145163 missense probably benign 0.00
IGL01574:Ces4a APN 8 105145227 splice site probably benign
IGL01655:Ces4a APN 8 105147174 missense probably damaging 0.99
IGL03092:Ces4a APN 8 105148204 splice site probably benign
IGL03151:Ces4a APN 8 105148197 critical splice donor site probably null
F6893:Ces4a UTSW 8 105147227 missense possibly damaging 0.74
R0266:Ces4a UTSW 8 105141966 missense probably benign
R0659:Ces4a UTSW 8 105144922 splice site probably benign
R1239:Ces4a UTSW 8 105149498 missense probably damaging 1.00
R1467:Ces4a UTSW 8 105138035 missense possibly damaging 0.56
R1467:Ces4a UTSW 8 105138035 missense possibly damaging 0.56
R1505:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1509:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1598:Ces4a UTSW 8 105142821 missense probably damaging 1.00
R1734:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1736:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1737:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1738:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1744:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1951:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1953:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R2126:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R2129:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R2202:Ces4a UTSW 8 105146114 missense probably damaging 1.00
R4512:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R4865:Ces4a UTSW 8 105147158 missense probably benign 0.05
R4934:Ces4a UTSW 8 105137981 missense probably benign 0.30
R4936:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R5255:Ces4a UTSW 8 105142489 missense probably benign 0.00
R5342:Ces4a UTSW 8 105146143 missense probably benign 0.07
R5647:Ces4a UTSW 8 105146080 missense probably benign 0.10
R6062:Ces4a UTSW 8 105138174 critical splice donor site probably null
R6490:Ces4a UTSW 8 105149458 missense probably benign 0.09
R6606:Ces4a UTSW 8 105149378 missense possibly damaging 0.95
R6876:Ces4a UTSW 8 105144992 missense possibly damaging 0.56
R6901:Ces4a UTSW 8 105146698 missense probably benign
R7519:Ces4a UTSW 8 105145219 missense probably damaging 1.00
R7682:Ces4a UTSW 8 105146665 missense probably benign 0.00
Z1176:Ces4a UTSW 8 105131977 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCAGATGTACCAGAATCCC -3'
(R):5'- AACCGAAGCCAAGAATAGGTTC -3'

Sequencing Primer
(F):5'- TCCCATCCATGGTTGAGAAGC -3'
(R):5'- CCAAGAATAGGTTCCAGGTTTGC -3'
Posted On2014-06-23