Incidental Mutation 'R1789:Chrna5'
ID 201631
Institutional Source Beutler Lab
Gene Symbol Chrna5
Ensembl Gene ENSMUSG00000035594
Gene Name cholinergic receptor, nicotinic, alpha polypeptide 5
Synonyms Acra-5, Acra5
MMRRC Submission 039820-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.200) question?
Stock # R1789 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 54888164-54915063 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 54911935 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 245 (V245A)
Ref Sequence ENSEMBL: ENSMUSP00000150942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093844] [ENSMUST00000213960] [ENSMUST00000217408]
AlphaFold Q2MKA5
Predicted Effect possibly damaging
Transcript: ENSMUST00000093844
AA Change: V216A

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091365
Gene: ENSMUSG00000035594
AA Change: V216A

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 18 221 4.9e-72 PFAM
Pfam:Neur_chan_memb 228 352 1.9e-51 PFAM
Pfam:Neur_chan_memb 338 417 1.2e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213960
AA Change: V245A

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217408
AA Change: V141A

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nicotinic acetylcholine receptor subunit and a member of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. These receptors are thought to be heteropentamers composed of separate but similar subunits. Defects in this gene have been linked to susceptibility to lung cancer type 2 (LNCR2).[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are less sensitive to nicotine-induced seizures than wild-type controls and exhibit a significantly shorter latency time to seizure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G A 16: 20,184,701 (GRCm39) P986L probably damaging Het
Acad10 A T 5: 121,769,456 (GRCm39) Y667N possibly damaging Het
Ahi1 G A 10: 20,839,014 (GRCm39) G121D probably benign Het
Ampd1 T A 3: 103,006,442 (GRCm39) I690N possibly damaging Het
Amy1 C A 3: 113,351,814 (GRCm39) W425L possibly damaging Het
Arhgap27 A T 11: 103,223,831 (GRCm39) V823E probably damaging Het
Arhgef17 A G 7: 100,579,077 (GRCm39) S624P probably damaging Het
Arid5b T C 10: 68,021,897 (GRCm39) H231R probably damaging Het
Aspscr1 C A 11: 120,579,386 (GRCm39) T78N probably damaging Het
Auts2 T A 5: 131,501,288 (GRCm39) T42S probably damaging Het
Ccdc171 A G 4: 83,473,045 (GRCm39) D158G probably damaging Het
Ces4a G A 8: 105,864,729 (GRCm39) G69S probably damaging Het
Cfap61 T C 2: 145,781,913 (GRCm39) probably null Het
Cntnap5c G A 17: 58,320,916 (GRCm39) G163R probably damaging Het
Col5a2 A G 1: 45,417,465 (GRCm39) probably null Het
Col5a2 T C 1: 45,433,936 (GRCm39) Q759R probably damaging Het
Comp A G 8: 70,829,796 (GRCm39) D340G probably benign Het
Cyfip1 T A 7: 55,576,143 (GRCm39) D1104E probably damaging Het
Dnah11 A T 12: 118,002,515 (GRCm39) S308T probably damaging Het
Dnah5 A G 15: 28,270,572 (GRCm39) H958R probably benign Het
Elp3 A G 14: 65,785,368 (GRCm39) Y478H probably damaging Het
Fam237b A T 5: 5,625,652 (GRCm39) Q116L possibly damaging Het
Fat3 T C 9: 16,288,281 (GRCm39) Y414C probably benign Het
Fbxo10 C A 4: 45,046,389 (GRCm39) A574S probably damaging Het
Fsip2 G T 2: 82,807,906 (GRCm39) L1408F probably benign Het
Fubp3 T C 2: 31,501,747 (GRCm39) V425A possibly damaging Het
Gm7168 A T 17: 14,169,846 (GRCm39) R404S probably benign Het
Gpd1 T G 15: 99,621,083 (GRCm39) F299C probably damaging Het
Gpr137 C T 19: 6,919,425 (GRCm39) probably benign Het
Grin3b T C 10: 79,809,242 (GRCm39) S331P probably benign Het
Grk3 T A 5: 113,089,584 (GRCm39) I281F probably damaging Het
Hoxb7 T A 11: 96,177,607 (GRCm39) S18R probably damaging Het
Igf1r C T 7: 67,864,681 (GRCm39) R1160* probably null Het
Itfg1 A G 8: 86,452,141 (GRCm39) probably null Het
Itgb8 T C 12: 119,166,190 (GRCm39) I114V probably benign Het
Kcnk1 A G 8: 126,752,123 (GRCm39) E243G possibly damaging Het
Kif27 A G 13: 58,491,822 (GRCm39) L439P probably damaging Het
Kif2c T A 4: 117,024,558 (GRCm39) Q279L probably benign Het
Kmt2d A T 15: 98,749,955 (GRCm39) probably benign Het
L3mbtl1 A G 2: 162,816,422 (GRCm39) T821A probably benign Het
Lrrc24 A T 15: 76,606,778 (GRCm39) M206K probably benign Het
Mamdc4 T G 2: 25,457,634 (GRCm39) K460Q possibly damaging Het
Maml2 C G 9: 13,608,641 (GRCm39) L30V probably damaging Het
Mc5r C G 18: 68,471,741 (GRCm39) probably null Het
Myo10 T G 15: 25,726,611 (GRCm39) probably null Het
Myo1e T A 9: 70,246,066 (GRCm39) L419Q probably damaging Het
Myo6 C A 9: 80,207,854 (GRCm39) H1115Q probably damaging Het
Myo7a A G 7: 97,756,302 (GRCm39) V10A probably damaging Het
Myoz2 C T 3: 122,819,776 (GRCm39) R61H probably damaging Het
Ncdn G A 4: 126,645,796 (GRCm39) R38C probably damaging Het
Nckap1 T A 2: 80,350,900 (GRCm39) T736S probably benign Het
Ncor2 G A 5: 125,096,954 (GRCm39) A2325V probably damaging Het
Nid2 T A 14: 19,802,499 (GRCm39) V140E possibly damaging Het
Nlrp9c C A 7: 26,079,915 (GRCm39) D704Y probably benign Het
Notch3 T A 17: 32,377,699 (GRCm39) S126C probably damaging Het
Or2g7 T C 17: 38,378,839 (GRCm39) I259T probably damaging Het
Or5p60 A G 7: 107,724,122 (GRCm39) F116S probably benign Het
Or5w10 A T 2: 87,375,327 (GRCm39) L187H probably damaging Het
Or6c219 A T 10: 129,781,451 (GRCm39) L160* probably null Het
Or6c6c T C 10: 129,541,476 (GRCm39) M243T possibly damaging Het
Or6d15 A C 6: 116,559,658 (GRCm39) F83C probably damaging Het
Pdzd7 A G 19: 45,027,667 (GRCm39) I269T probably damaging Het
Phf3 A T 1: 30,845,287 (GRCm39) D1299E probably damaging Het
Pitx2 T A 3: 129,012,403 (GRCm39) Y271N probably damaging Het
Polk T C 13: 96,633,140 (GRCm39) E301G probably damaging Het
Prkdc C A 16: 15,557,388 (GRCm39) N2230K probably damaging Het
Prlr A G 15: 10,322,622 (GRCm39) E170G probably benign Het
Prss55 A G 14: 64,313,179 (GRCm39) I235T probably damaging Het
Psd3 T C 8: 68,413,217 (GRCm39) I724V probably benign Het
Rabep2 A G 7: 126,037,971 (GRCm39) T248A possibly damaging Het
Rbm26 T A 14: 105,354,509 (GRCm39) K949N probably benign Het
Rnf213 T A 11: 119,331,047 (GRCm39) D2085E probably damaging Het
Serpinb7 A T 1: 107,378,003 (GRCm39) H232L possibly damaging Het
Slu7 A G 11: 43,336,069 (GRCm39) Q484R probably benign Het
Smg1 A G 7: 117,745,021 (GRCm39) S3044P possibly damaging Het
Snrnp48 A G 13: 38,405,336 (GRCm39) D248G possibly damaging Het
Snrpc C A 17: 28,064,193 (GRCm39) P66Q unknown Het
Snrpn T A 7: 59,633,207 (GRCm39) probably benign Het
Spag17 T A 3: 99,846,672 (GRCm39) S65R possibly damaging Het
Srsf6 C A 2: 162,776,408 (GRCm39) probably benign Het
Stil T A 4: 114,898,979 (GRCm39) M1203K probably benign Het
Syt17 T C 7: 118,036,061 (GRCm39) T106A probably benign Het
Tbx15 C T 3: 99,259,562 (GRCm39) Q478* probably null Het
Tg A T 15: 66,609,397 (GRCm39) Q319L probably benign Het
Thada A G 17: 84,755,461 (GRCm39) L243P probably damaging Het
Thada G T 17: 84,755,462 (GRCm39) L243I probably damaging Het
Tnnt3 A G 7: 142,066,101 (GRCm39) R211G probably damaging Het
Togaram1 A T 12: 65,049,409 (GRCm39) Q1282L possibly damaging Het
Tpm3-rs7 T G 14: 113,552,379 (GRCm39) M91R probably damaging Het
Trappc9 G A 15: 72,897,816 (GRCm39) R377W probably damaging Het
Ttll7 T G 3: 146,621,535 (GRCm39) L378R probably damaging Het
Tyw1 T G 5: 130,287,834 (GRCm39) I22R probably damaging Het
Ubr3 T C 2: 69,846,711 (GRCm39) S1645P possibly damaging Het
Ubr4 T C 4: 139,120,364 (GRCm39) L263P probably damaging Het
Unc13c T C 9: 73,663,621 (GRCm39) E1071G possibly damaging Het
Vmn2r44 G T 7: 8,383,122 (GRCm39) D157E possibly damaging Het
Vps16 C T 2: 130,285,520 (GRCm39) T821I probably benign Het
Washc4 T C 10: 83,415,389 (GRCm39) V793A possibly damaging Het
Wdr35 G T 12: 9,027,435 (GRCm39) probably null Het
Zfp277 A G 12: 40,414,084 (GRCm39) F254L probably benign Het
Other mutations in Chrna5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Chrna5 APN 9 54,911,683 (GRCm39) missense possibly damaging 0.61
IGL01503:Chrna5 APN 9 54,905,455 (GRCm39) intron probably benign
IGL01617:Chrna5 APN 9 54,912,297 (GRCm39) missense probably damaging 0.98
IGL01935:Chrna5 APN 9 54,912,127 (GRCm39) missense probably benign 0.01
IGL02613:Chrna5 APN 9 54,913,705 (GRCm39) missense probably damaging 0.99
IGL03248:Chrna5 APN 9 54,911,923 (GRCm39) missense probably damaging 1.00
IGL03412:Chrna5 APN 9 54,911,719 (GRCm39) missense probably damaging 1.00
R0712:Chrna5 UTSW 9 54,911,647 (GRCm39) missense probably damaging 1.00
R1619:Chrna5 UTSW 9 54,911,649 (GRCm39) missense probably benign 0.00
R1698:Chrna5 UTSW 9 54,911,926 (GRCm39) missense probably damaging 1.00
R1800:Chrna5 UTSW 9 54,912,159 (GRCm39) missense probably damaging 0.99
R4028:Chrna5 UTSW 9 54,905,370 (GRCm39) missense probably damaging 1.00
R4030:Chrna5 UTSW 9 54,905,370 (GRCm39) missense probably damaging 1.00
R4031:Chrna5 UTSW 9 54,905,370 (GRCm39) missense probably damaging 1.00
R4201:Chrna5 UTSW 9 54,905,359 (GRCm39) missense probably benign 0.00
R4792:Chrna5 UTSW 9 54,911,985 (GRCm39) missense probably damaging 1.00
R5196:Chrna5 UTSW 9 54,913,803 (GRCm39) missense possibly damaging 0.91
R5718:Chrna5 UTSW 9 54,905,389 (GRCm39) missense probably benign 0.00
R5779:Chrna5 UTSW 9 54,905,388 (GRCm39) missense probably benign 0.35
R6254:Chrna5 UTSW 9 54,913,740 (GRCm39) missense probably benign 0.00
R6492:Chrna5 UTSW 9 54,905,347 (GRCm39) missense probably benign 0.11
R6887:Chrna5 UTSW 9 54,912,417 (GRCm39) missense probably benign 0.00
R6986:Chrna5 UTSW 9 54,913,741 (GRCm39) missense possibly damaging 0.83
R7056:Chrna5 UTSW 9 54,888,985 (GRCm39) intron probably benign
R7222:Chrna5 UTSW 9 54,905,347 (GRCm39) missense probably benign 0.11
R7384:Chrna5 UTSW 9 54,912,117 (GRCm39) missense probably damaging 1.00
R7572:Chrna5 UTSW 9 54,913,749 (GRCm39) missense probably damaging 1.00
R7653:Chrna5 UTSW 9 54,909,718 (GRCm39) missense probably benign
R7846:Chrna5 UTSW 9 54,912,391 (GRCm39) missense probably benign 0.38
R8808:Chrna5 UTSW 9 54,905,348 (GRCm39) missense probably benign 0.20
R8901:Chrna5 UTSW 9 54,911,737 (GRCm39) missense probably damaging 1.00
R9303:Chrna5 UTSW 9 54,912,156 (GRCm39) missense probably benign 0.16
R9716:Chrna5 UTSW 9 54,911,919 (GRCm39) missense probably benign 0.00
Z1176:Chrna5 UTSW 9 54,911,766 (GRCm39) missense probably damaging 1.00
Z1177:Chrna5 UTSW 9 54,912,240 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TTGCTCCATGAAATTCGGCTC -3'
(R):5'- GTACTCCCCGATCAGAGGTATG -3'

Sequencing Primer
(F):5'- CTCATGGACGTATGATGGATCCCAG -3'
(R):5'- CCCCGATCAGAGGTATGACTTTG -3'
Posted On 2014-06-23