Mutagenetix > Incidental Mutation

Incidental Mutation 'R1789:Myo1e'

201632

Institutional Source

Beutler Lab

Gene Symbol

Myo1e

Ensembl Gene

ENSMUSG00000032220

Gene Name

myosin IE

Synonyms

2310020N23Rik, 9130023P14Rik

MMRRC Submission

039820-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1789 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70207350-70399766 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 70338784 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 419 (L419Q)

Ref Sequence

ENSEMBL: ENSMUSP00000034745 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034745] [ENSMUST00000214042]

AlphaFold

E9Q634

PDB Structure

MYOSIN 1E SH3 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034745
AA Change: L419Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034745
Gene: ENSMUSG00000032220
AA Change: L419Q

Domain	Start	End	E-Value	Type
MYSc	13	693	N/A	SMART
Pfam:Myosin_TH1	719	917	1e-55	PFAM
SH3	1053	1107	2.12e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000214042

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214767

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nonmuscle class I myosins which are a subgroup of the unconventional myosin protein family. The unconventional myosin proteins function as actin-based molecular motors. Class I myosins are characterized by a head (motor) domain, a regulatory domain and a either a short or long tail domain. Among the class I myosins, this protein is distinguished by a long tail domain that is involved in crosslinking actin filaments. This protein localizes to the cytoplasm and may be involved in intracellular movement and membrane trafficking. Mutations in this gene are the cause of focal segmental glomerulosclerosis-6. This gene has been referred to as myosin IC in the literature but is distinct from the myosin IC gene located on chromosome 17. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for a gene trapped allele exhibit embryonic lethality, embryonic hemorrhaging and hematopoietic defects. Homozygotes for a knock-out allele show proteinuria, chronic renal injury, kidney inflammation, and defects in renal filtration and podocyte organization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	G	A	16: 20,365,951	P986L	probably damaging	Het
Acad10	A	T	5: 121,631,393	Y667N	possibly damaging	Het
Ahi1	G	A	10: 20,963,115	G121D	probably benign	Het
Ampd1	T	A	3: 103,099,126	I690N	possibly damaging	Het
Amy1	C	A	3: 113,558,165	W425L	possibly damaging	Het
Arhgap27	A	T	11: 103,333,005	V823E	probably damaging	Het
Arhgef17	A	G	7: 100,929,870	S624P	probably damaging	Het
Arid5b	T	C	10: 68,186,067	H231R	probably damaging	Het
Aspscr1	C	A	11: 120,688,560	T78N	probably damaging	Het
Auts2	T	A	5: 131,472,450	T42S	probably damaging	Het
Ccdc171	A	G	4: 83,554,808	D158G	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap61	T	C	2: 145,939,993		probably null	Het
Chrna5	T	C	9: 55,004,651	V245A	possibly damaging	Het
Cntnap5c	G	A	17: 58,013,921	G163R	probably damaging	Het
Col5a2	T	C	1: 45,394,776	Q759R	probably damaging	Het
Col5a2	A	G	1: 45,378,305		probably null	Het
Comp	A	G	8: 70,377,146	D340G	probably benign	Het
Cyfip1	T	A	7: 55,926,395	D1104E	probably damaging	Het
Dnah11	A	T	12: 118,038,780	S308T	probably damaging	Het
Dnah5	A	G	15: 28,270,426	H958R	probably benign	Het
Elp3	A	G	14: 65,547,919	Y478H	probably damaging	Het
Fat3	T	C	9: 16,376,985	Y414C	probably benign	Het
Fbxo10	C	A	4: 45,046,389	A574S	probably damaging	Het
Fsip2	G	T	2: 82,977,562	L1408F	probably benign	Het
Fubp3	T	C	2: 31,611,735	V425A	possibly damaging	Het
Gm7168	A	T	17: 13,949,584	R404S	probably benign	Het
Gm8773	A	T	5: 5,575,652	Q116L	possibly damaging	Het
Gpd1	T	G	15: 99,723,202	F299C	probably damaging	Het
Gpr137	C	T	19: 6,942,057		probably benign	Het
Grin3b	T	C	10: 79,973,408	S331P	probably benign	Het
Grk3	T	A	5: 112,941,718	I281F	probably damaging	Het
Hoxb7	T	A	11: 96,286,781	S18R	probably damaging	Het
Igf1r	C	T	7: 68,214,933	R1160*	probably null	Het
Itfg1	A	G	8: 85,725,512		probably null	Het
Itgb8	T	C	12: 119,202,455	I114V	probably benign	Het
Kcnk1	A	G	8: 126,025,384	E243G	possibly damaging	Het
Kif27	A	G	13: 58,344,008	L439P	probably damaging	Het
Kif2c	T	A	4: 117,167,361	Q279L	probably benign	Het
Kmt2d	A	T	15: 98,852,074		probably benign	Het
L3mbtl1	A	G	2: 162,974,502	T821A	probably benign	Het
Lrrc24	A	T	15: 76,722,578	M206K	probably benign	Het
Mamdc4	T	G	2: 25,567,622	K460Q	possibly damaging	Het
Maml2	C	G	9: 13,697,345	L30V	probably damaging	Het
Mc5r	C	G	18: 68,338,670		probably null	Het
Myo10	T	G	15: 25,726,525		probably null	Het
Myo6	C	A	9: 80,300,572	H1115Q	probably damaging	Het
Myo7a	A	G	7: 98,107,095	V10A	probably damaging	Het
Myoz2	C	T	3: 123,026,127	R61H	probably damaging	Het
Ncdn	G	A	4: 126,752,003	R38C	probably damaging	Het
Nckap1	T	A	2: 80,520,556	T736S	probably benign	Het
Ncor2	G	A	5: 125,019,890	A2325V	probably damaging	Het
Nid2	T	A	14: 19,752,431	V140E	possibly damaging	Het
Nlrp9c	C	A	7: 26,380,490	D704Y	probably benign	Het
Notch3	T	A	17: 32,158,725	S126C	probably damaging	Het
Olfr1128	A	T	2: 87,544,983	L187H	probably damaging	Het
Olfr130	T	C	17: 38,067,948	I259T	probably damaging	Het
Olfr215	A	C	6: 116,582,697	F83C	probably damaging	Het
Olfr484	A	G	7: 108,124,915	F116S	probably benign	Het
Olfr804	T	C	10: 129,705,607	M243T	possibly damaging	Het
Olfr818	A	T	10: 129,945,582	L160*	probably null	Het
Pdzd7	A	G	19: 45,039,228	I269T	probably damaging	Het
Phf3	A	T	1: 30,806,206	D1299E	probably damaging	Het
Pitx2	T	A	3: 129,218,754	Y271N	probably damaging	Het
Polk	T	C	13: 96,496,632	E301G	probably damaging	Het
Prkdc	C	A	16: 15,739,524	N2230K	probably damaging	Het
Prlr	A	G	15: 10,322,536	E170G	probably benign	Het
Prss55	A	G	14: 64,075,730	I235T	probably damaging	Het
Psd3	T	C	8: 67,960,565	I724V	probably benign	Het
Rabep2	A	G	7: 126,438,799	T248A	possibly damaging	Het
Rbm26	T	A	14: 105,117,073	K949N	probably benign	Het
Rnf213	T	A	11: 119,440,221	D2085E	probably damaging	Het
Serpinb7	A	T	1: 107,450,273	H232L	possibly damaging	Het
Slu7	A	G	11: 43,445,242	Q484R	probably benign	Het
Smg1	A	G	7: 118,145,798	S3044P	possibly damaging	Het
Snrnp48	A	G	13: 38,221,360	D248G	possibly damaging	Het
Snrpc	C	A	17: 27,845,219	P66Q	unknown	Het
Snrpn	T	A	7: 59,983,459		probably benign	Het
Spag17	T	A	3: 99,939,356	S65R	possibly damaging	Het
Srsf6	C	A	2: 162,934,488		probably benign	Het
Stil	T	A	4: 115,041,782	M1203K	probably benign	Het
Syt17	T	C	7: 118,436,838	T106A	probably benign	Het
Tbx15	C	T	3: 99,352,246	Q478*	probably null	Het
Tg	A	T	15: 66,737,548	Q319L	probably benign	Het
Thada	A	G	17: 84,448,033	L243P	probably damaging	Het
Thada	G	T	17: 84,448,034	L243I	probably damaging	Het
Tnnt3	A	G	7: 142,512,364	R211G	probably damaging	Het
Togaram1	A	T	12: 65,002,635	Q1282L	possibly damaging	Het
Tpm3-rs7	T	G	14: 113,314,947	M91R	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Ttll7	T	G	3: 146,915,780	L378R	probably damaging	Het
Tyw1	T	G	5: 130,258,993	I22R	probably damaging	Het
Ubr3	T	C	2: 70,016,367	S1645P	possibly damaging	Het
Ubr4	T	C	4: 139,393,053	L263P	probably damaging	Het
Unc13c	T	C	9: 73,756,339	E1071G	possibly damaging	Het
Vmn2r44	G	T	7: 8,380,123	D157E	possibly damaging	Het
Vps16	C	T	2: 130,443,600	T821I	probably benign	Het
Washc4	T	C	10: 83,579,525	V793A	possibly damaging	Het
Wdr35	G	T	12: 8,977,435		probably null	Het
Zfp277	A	G	12: 40,364,085	F254L	probably benign	Het

Other mutations in Myo1e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00817:Myo1e	APN	9	70342148	missense	probably benign	0.01
IGL00833:Myo1e	APN	9	70338778	missense	probably damaging	0.99
IGL00973:Myo1e	APN	9	70338787	missense	probably damaging	1.00
IGL01011:Myo1e	APN	9	70316589	splice site	probably benign
IGL01401:Myo1e	APN	9	70327166	missense	probably damaging	0.97
IGL01402:Myo1e	APN	9	70337766	missense	probably benign	0.02
IGL01404:Myo1e	APN	9	70337766	missense	probably benign	0.02
IGL01613:Myo1e	APN	9	70341273	splice site	probably benign
IGL01738:Myo1e	APN	9	70359370	missense	probably damaging	1.00
IGL01819:Myo1e	APN	9	70343040	splice site	probably benign
IGL02233:Myo1e	APN	9	70383799	splice site	probably benign
IGL02244:Myo1e	APN	9	70367689	missense	probably benign	0.00
IGL02440:Myo1e	APN	9	70346740	missense	probably damaging	1.00
IGL02806:Myo1e	APN	9	70362270	missense	probably benign	0.01
IGL02886:Myo1e	APN	9	70368773	missense	probably benign	0.00
IGL03178:Myo1e	APN	9	70286949	missense	possibly damaging	0.47
I2288:Myo1e	UTSW	9	70342097	missense	possibly damaging	0.80
R0036:Myo1e	UTSW	9	70341308	missense	probably damaging	1.00
R0238:Myo1e	UTSW	9	70342126	missense	possibly damaging	0.86
R0238:Myo1e	UTSW	9	70342126	missense	possibly damaging	0.86
R0399:Myo1e	UTSW	9	70301793	splice site	probably benign
R0526:Myo1e	UTSW	9	70322398	missense	probably damaging	1.00
R0599:Myo1e	UTSW	9	70376660	splice site	probably benign
R0656:Myo1e	UTSW	9	70367674	missense	probably damaging	1.00
R1078:Myo1e	UTSW	9	70383999	missense	probably benign
R1278:Myo1e	UTSW	9	70398785	missense	probably damaging	1.00
R1300:Myo1e	UTSW	9	70301783	missense	probably damaging	1.00
R1329:Myo1e	UTSW	9	70338738	missense	possibly damaging	0.96
R1349:Myo1e	UTSW	9	70287069	splice site	probably benign
R1463:Myo1e	UTSW	9	70338756	missense	possibly damaging	0.88
R1656:Myo1e	UTSW	9	70395934	missense	probably damaging	1.00
R1727:Myo1e	UTSW	9	70376524	missense	possibly damaging	0.88
R1970:Myo1e	UTSW	9	70368773	missense	probably benign	0.00
R2029:Myo1e	UTSW	9	70368687	missense	possibly damaging	0.78
R2029:Myo1e	UTSW	9	70378715	splice site	probably benign
R2039:Myo1e	UTSW	9	70320133	missense	possibly damaging	0.89
R2076:Myo1e	UTSW	9	70383877	missense	probably benign
R2256:Myo1e	UTSW	9	70378373	splice site	probably null
R2257:Myo1e	UTSW	9	70378373	splice site	probably null
R2323:Myo1e	UTSW	9	70378758	nonsense	probably null
R2443:Myo1e	UTSW	9	70327172	missense	probably benign
R4023:Myo1e	UTSW	9	70324875	missense	probably benign
R4024:Myo1e	UTSW	9	70324875	missense	probably benign
R4025:Myo1e	UTSW	9	70324875	missense	probably benign
R4026:Myo1e	UTSW	9	70324875	missense	probably benign
R4151:Myo1e	UTSW	9	70297351	nonsense	probably null
R4764:Myo1e	UTSW	9	70343135	splice site	probably null
R4768:Myo1e	UTSW	9	70370469	missense	possibly damaging	0.63
R4911:Myo1e	UTSW	9	70343096	missense	probably benign
R4995:Myo1e	UTSW	9	70353272	missense	probably benign	0.01
R4999:Myo1e	UTSW	9	70353312	missense	probably damaging	1.00
R5228:Myo1e	UTSW	9	70322358	splice site	probably null
R5414:Myo1e	UTSW	9	70322358	splice site	probably null
R5577:Myo1e	UTSW	9	70370471	missense	probably benign	0.31
R5851:Myo1e	UTSW	9	70383804	missense	probably benign	0.17
R6208:Myo1e	UTSW	9	70376605	missense	probably damaging	0.99
R6907:Myo1e	UTSW	9	70327155	missense	probably benign
R7084:Myo1e	UTSW	9	70337801	missense	probably damaging	0.96
R7313:Myo1e	UTSW	9	70359385	critical splice donor site	probably null
R7383:Myo1e	UTSW	9	70297295	missense	probably damaging	1.00
R7811:Myo1e	UTSW	9	70327262	missense	probably damaging	0.96
R7962:Myo1e	UTSW	9	70335219	missense	possibly damaging	0.64
R8309:Myo1e	UTSW	9	70346763	missense	possibly damaging	0.90
R8510:Myo1e	UTSW	9	70335265	missense	probably damaging	1.00
R8513:Myo1e	UTSW	9	70320088	missense	probably damaging	1.00
R8694:Myo1e	UTSW	9	70383890	missense	probably benign
R8720:Myo1e	UTSW	9	70297288	missense	possibly damaging	0.89
R9112:Myo1e	UTSW	9	70367701	missense	probably benign	0.25
R9148:Myo1e	UTSW	9	70376548	missense	probably damaging	0.98
R9156:Myo1e	UTSW	9	70359323	missense	probably damaging	1.00
R9251:Myo1e	UTSW	9	70368794	missense	probably benign	0.00
R9541:Myo1e	UTSW	9	70297346	missense	probably damaging	1.00
R9624:Myo1e	UTSW	9	70395874	missense	probably damaging	1.00
R9660:Myo1e	UTSW	9	70316642	missense	probably damaging	1.00
R9728:Myo1e	UTSW	9	70316642	missense	probably damaging	1.00
X0021:Myo1e	UTSW	9	70378273	missense	probably damaging	0.99
X0065:Myo1e	UTSW	9	70378294	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- GCTTCCTCTATTGACGTAGCTG -3'
(R):5'- ACACACAACAGATGGTATTTGC -3'

Sequencing Primer
(F):5'- GGAGTTTCTGAAACAGCTTTCACAGG -3'
(R):5'- CACACAACAGATGGTATTTGCATTTC -3'

Posted On

2014-06-23