Incidental Mutation 'R0090:Slc16a5'
ID20164
Institutional Source Beutler Lab
Gene Symbol Slc16a5
Ensembl Gene ENSMUSG00000045775
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 5
SynonymsMCT5, A130015N09Rik
MMRRC Submission 038377-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0090 (G1)
Quality Score129
Status Validated (trace)
Chromosome11
Chromosomal Location115462474-115474398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115464925 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 71 (S71C)
Ref Sequence ENSEMBL: ENSMUSP00000090102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092445] [ENSMUST00000106532] [ENSMUST00000153466]
Predicted Effect probably damaging
Transcript: ENSMUST00000092445
AA Change: S71C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090102
Gene: ENSMUSG00000045775
AA Change: S71C

DomainStartEndE-ValueType
Pfam:MFS_1 15 303 5.9e-31 PFAM
Pfam:MFS_1 302 459 6.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106532
SMART Domains Protein: ENSMUSP00000102142
Gene: ENSMUSG00000045775

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140739
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146500
Predicted Effect probably damaging
Transcript: ENSMUST00000153466
AA Change: S71C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117727
Gene: ENSMUSG00000045775
AA Change: S71C

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 85 107 N/A INTRINSIC
Meta Mutation Damage Score 0.6567 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.7%
  • 20x: 91.4%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the monocarboxylate transporter family and the major facilitator superfamily. The encoded protein is localized to the cell membrane and acts as a proton-linked transporter of bumetanide. Transport by the encoded protein is inhibited by four loop diuretics, nateglinide, thiazides, probenecid, and glibenclamide. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
4933427I04Rik A G 4: 123,860,982 T230A possibly damaging Het
9230110C19Rik T A 9: 8,027,183 N118I probably benign Het
Acsm1 T C 7: 119,662,189 probably benign Het
Acta1 T C 8: 123,893,657 N14S probably damaging Het
Aff4 A G 11: 53,392,782 T362A probably benign Het
Aggf1 A G 13: 95,364,959 I305T probably benign Het
Ap4b1 A G 3: 103,820,429 D325G possibly damaging Het
Ap4e1 C T 2: 127,064,985 T1055I possibly damaging Het
Arhgef2 A T 3: 88,639,348 Q496L probably damaging Het
Arhgef28 A G 13: 98,075,110 F122L probably damaging Het
Baiap3 G A 17: 25,250,070 probably benign Het
Casp8ap2 T A 4: 32,640,327 H460Q probably damaging Het
Casz1 A G 4: 148,933,411 T386A probably benign Het
Cd53 A T 3: 106,767,409 V114E possibly damaging Het
Celsr2 A G 3: 108,393,327 probably benign Het
Chaf1b G T 16: 93,887,124 A88S possibly damaging Het
Cldn10 A T 14: 118,874,200 Y194F probably damaging Het
Clec2e A C 6: 129,095,218 probably null Het
Cmpk2 A T 12: 26,478,022 T413S probably benign Het
Col9a1 T A 1: 24,223,562 probably null Het
Dchs1 G T 7: 105,755,932 Q2468K probably benign Het
Ddx60 A G 8: 61,942,293 D88G probably damaging Het
Dnah8 A G 17: 30,784,090 R3588G probably benign Het
Ect2 T C 3: 27,115,476 T774A probably benign Het
Ect2 C T 3: 27,138,502 E431K probably null Het
Ern1 A G 11: 106,405,823 V767A probably damaging Het
Fbln1 A C 15: 85,224,288 E75A possibly damaging Het
Fgf5 C T 5: 98,261,987 R132* probably null Het
Folh1 T C 7: 86,725,868 probably benign Het
Gdf15 A T 8: 70,629,684 H257Q probably damaging Het
Ghitm T C 14: 37,122,219 T322A probably benign Het
Gm13212 A T 4: 145,622,625 K211* probably null Het
Gm5709 A G 3: 59,618,771 noncoding transcript Het
Hbb-y C T 7: 103,852,743 probably null Het
Hmcn2 A T 2: 31,426,198 D3771V probably damaging Het
Hspa12a T C 19: 58,799,509 D627G probably benign Het
Idh2 T C 7: 80,097,914 E286G probably damaging Het
Idh3b C A 2: 130,280,979 A297S probably benign Het
Igsf3 A G 3: 101,435,652 E535G probably damaging Het
Ilf3 T A 9: 21,395,414 D314E probably damaging Het
Itgb8 A G 12: 119,202,563 S78P probably benign Het
Itih5 G A 2: 10,164,684 V31I probably benign Het
Kcnj2 T C 11: 111,073,027 V415A probably benign Het
Kin A G 2: 10,085,773 Q53R possibly damaging Het
Krt78 A T 15: 101,947,837 M513K probably benign Het
Krtap4-8 A T 11: 99,780,486 probably benign Het
Ltbr T C 6: 125,309,449 probably benign Het
Mgat4a G A 1: 37,490,333 T146I probably damaging Het
Mrps2 G C 2: 28,468,256 W19C probably damaging Het
Mthfs T C 9: 89,211,291 S33P probably damaging Het
Myh6 T C 14: 54,958,704 D546G probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Ndst2 T C 14: 20,727,267 T553A probably damaging Het
Nlrp12 T C 7: 3,240,034 E616G probably damaging Het
Nrde2 T C 12: 100,129,286 probably benign Het
Nup210l G A 3: 90,211,779 V1832I probably benign Het
Olfr1283 A T 2: 111,369,294 I221F probably damaging Het
Olfr376 G A 11: 73,375,576 V276I probably benign Het
Pcm1 A T 8: 41,256,041 E9D probably damaging Het
Pear1 A T 3: 87,754,342 D541E possibly damaging Het
Peg10 A G 6: 4,756,063 probably benign Het
Prss1 G A 6: 41,461,232 R31Q probably benign Het
Ptpn13 T C 5: 103,569,503 V1837A probably damaging Het
Rasgrp3 A G 17: 75,498,461 D149G probably damaging Het
Reg3d A T 6: 78,378,483 H8Q possibly damaging Het
Rhox4f A C X: 37,607,469 V15G probably benign Het
Sacs T A 14: 61,205,440 L1645H probably damaging Het
Slc9a3 A G 13: 74,158,728 E324G probably damaging Het
Smgc T C 15: 91,859,762 V574A possibly damaging Het
Stac3 C T 10: 127,503,930 probably benign Het
Supv3l1 A G 10: 62,429,706 L685P probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tas2r125 G T 6: 132,910,398 A250S probably benign Het
Tdrd6 C T 17: 43,628,241 V639I probably benign Het
Thap12 T G 7: 98,715,893 W423G probably damaging Het
Tmem245 T C 4: 56,899,410 I217V probably benign Het
Trip12 T A 1: 84,732,136 probably benign Het
Tshz3 T C 7: 36,768,892 V102A probably benign Het
Ubap1 T C 4: 41,379,826 S347P probably damaging Het
Usp10 C T 8: 119,953,196 Q612* probably null Het
Vmn2r72 T C 7: 85,754,876 I36V probably benign Het
Vps37a T C 8: 40,526,989 I63T possibly damaging Het
Whrn C A 4: 63,432,732 R9L possibly damaging Het
Xrcc1 T C 7: 24,570,217 Y401H probably damaging Het
Ylpm1 GCCTAAGCAGCAACCTAAG GCCTAAG 12: 85,029,040 probably benign Het
Zfhx3 G A 8: 108,950,057 D2580N possibly damaging Het
Zfhx4 A G 3: 5,243,625 N637S probably damaging Het
Zyg11a A T 4: 108,201,347 probably benign Het
Other mutations in Slc16a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01832:Slc16a5 APN 11 115465001 missense probably benign
IGL02190:Slc16a5 APN 11 115462609 start codon destroyed probably null 1.00
IGL02852:Slc16a5 APN 11 115469579 missense probably benign 0.03
IGL02942:Slc16a5 APN 11 115469350 missense possibly damaging 0.50
R1928:Slc16a5 UTSW 11 115470016 missense probably damaging 0.98
R1930:Slc16a5 UTSW 11 115469368 missense probably damaging 0.99
R1931:Slc16a5 UTSW 11 115469368 missense probably damaging 0.99
R5255:Slc16a5 UTSW 11 115462675 missense probably benign 0.13
R5548:Slc16a5 UTSW 11 115469804 missense probably benign 0.32
R5592:Slc16a5 UTSW 11 115472782 missense probably benign 0.05
R5770:Slc16a5 UTSW 11 115472778 missense possibly damaging 0.70
R8381:Slc16a5 UTSW 11 115469890 missense probably benign
Z1176:Slc16a5 UTSW 11 115469372 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTACACCGCTCAACAGCTAGTCC -3'
(R):5'- CTCCTCTAGACTATAAGCAGTTCCACCC -3'

Sequencing Primer
(F):5'- ACCACTCATACTGTAGCGGG -3'
(R):5'- GCAGTTCCACCCACCCG -3'
Posted On2013-04-11