Mutagenetix > Incidental Mutation

Incidental Mutation 'R1789:Rnf213'

201645

Institutional Source

Beutler Lab

Gene Symbol

Rnf213

Ensembl Gene

ENSMUSG00000070327

Gene Name

ring finger protein 213

Synonyms

D11Ertd759e

MMRRC Submission

039820-MU

Accession Numbers

Genbank: XM_001477846.2; Ensembl: ENSMUST00000131035, ENSMUST00000082107, ENSMUST00000093902, ENSMUST00000169768, ENSMUST00000172235

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1789 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

119393100-119487418 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 119440221 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 2085 (D2085E)

Ref Sequence

ENSEMBL: ENSMUSP00000115063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000093902
AA Change: D2086E

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: D2086E

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1546	1558	N/A	INTRINSIC
AAA	2373	2515	2.82e-2	SMART
AAA	2722	2890	3.63e-1	SMART
low complexity region	3449	3459	N/A	INTRINSIC
RING	3947	3985	8.69e-5	SMART
Blast:PP2Ac	4544	4722	3e-66	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000131035
AA Change: D2085E

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: D2085E

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1113	1127	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
AAA	2372	2514	2.82e-2	SMART
AAA	2721	2889	3.63e-1	SMART
low complexity region	3448	3458	N/A	INTRINSIC
RING	3946	3984	8.69e-5	SMART
Blast:PP2Ac	4542	4720	3e-66	BLAST

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	G	A	16: 20,365,951	P986L	probably damaging	Het
Acad10	A	T	5: 121,631,393	Y667N	possibly damaging	Het
Ahi1	G	A	10: 20,963,115	G121D	probably benign	Het
Ampd1	T	A	3: 103,099,126	I690N	possibly damaging	Het
Amy1	C	A	3: 113,558,165	W425L	possibly damaging	Het
Arhgap27	A	T	11: 103,333,005	V823E	probably damaging	Het
Arhgef17	A	G	7: 100,929,870	S624P	probably damaging	Het
Arid5b	T	C	10: 68,186,067	H231R	probably damaging	Het
Aspscr1	C	A	11: 120,688,560	T78N	probably damaging	Het
Auts2	T	A	5: 131,472,450	T42S	probably damaging	Het
Ccdc171	A	G	4: 83,554,808	D158G	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap61	T	C	2: 145,939,993		probably null	Het
Chrna5	T	C	9: 55,004,651	V245A	possibly damaging	Het
Cntnap5c	G	A	17: 58,013,921	G163R	probably damaging	Het
Col5a2	A	G	1: 45,378,305		probably null	Het
Col5a2	T	C	1: 45,394,776	Q759R	probably damaging	Het
Comp	A	G	8: 70,377,146	D340G	probably benign	Het
Cyfip1	T	A	7: 55,926,395	D1104E	probably damaging	Het
Dnah11	A	T	12: 118,038,780	S308T	probably damaging	Het
Dnah5	A	G	15: 28,270,426	H958R	probably benign	Het
Elp3	A	G	14: 65,547,919	Y478H	probably damaging	Het
Fat3	T	C	9: 16,376,985	Y414C	probably benign	Het
Fbxo10	C	A	4: 45,046,389	A574S	probably damaging	Het
Fsip2	G	T	2: 82,977,562	L1408F	probably benign	Het
Fubp3	T	C	2: 31,611,735	V425A	possibly damaging	Het
Gm7168	A	T	17: 13,949,584	R404S	probably benign	Het
Gm8773	A	T	5: 5,575,652	Q116L	possibly damaging	Het
Gpd1	T	G	15: 99,723,202	F299C	probably damaging	Het
Gpr137	C	T	19: 6,942,057		probably benign	Het
Grin3b	T	C	10: 79,973,408	S331P	probably benign	Het
Grk3	T	A	5: 112,941,718	I281F	probably damaging	Het
Hoxb7	T	A	11: 96,286,781	S18R	probably damaging	Het
Igf1r	C	T	7: 68,214,933	R1160*	probably null	Het
Itfg1	A	G	8: 85,725,512		probably null	Het
Itgb8	T	C	12: 119,202,455	I114V	probably benign	Het
Kcnk1	A	G	8: 126,025,384	E243G	possibly damaging	Het
Kif27	A	G	13: 58,344,008	L439P	probably damaging	Het
Kif2c	T	A	4: 117,167,361	Q279L	probably benign	Het
Kmt2d	A	T	15: 98,852,074		probably benign	Het
L3mbtl1	A	G	2: 162,974,502	T821A	probably benign	Het
Lrrc24	A	T	15: 76,722,578	M206K	probably benign	Het
Mamdc4	T	G	2: 25,567,622	K460Q	possibly damaging	Het
Maml2	C	G	9: 13,697,345	L30V	probably damaging	Het
Mc5r	C	G	18: 68,338,670		probably null	Het
Myo10	T	G	15: 25,726,525		probably null	Het
Myo1e	T	A	9: 70,338,784	L419Q	probably damaging	Het
Myo6	C	A	9: 80,300,572	H1115Q	probably damaging	Het
Myo7a	A	G	7: 98,107,095	V10A	probably damaging	Het
Myoz2	C	T	3: 123,026,127	R61H	probably damaging	Het
Ncdn	G	A	4: 126,752,003	R38C	probably damaging	Het
Nckap1	T	A	2: 80,520,556	T736S	probably benign	Het
Ncor2	G	A	5: 125,019,890	A2325V	probably damaging	Het
Nid2	T	A	14: 19,752,431	V140E	possibly damaging	Het
Nlrp9c	C	A	7: 26,380,490	D704Y	probably benign	Het
Notch3	T	A	17: 32,158,725	S126C	probably damaging	Het
Olfr1128	A	T	2: 87,544,983	L187H	probably damaging	Het
Olfr130	T	C	17: 38,067,948	I259T	probably damaging	Het
Olfr215	A	C	6: 116,582,697	F83C	probably damaging	Het
Olfr484	A	G	7: 108,124,915	F116S	probably benign	Het
Olfr804	T	C	10: 129,705,607	M243T	possibly damaging	Het
Olfr818	A	T	10: 129,945,582	L160*	probably null	Het
Pdzd7	A	G	19: 45,039,228	I269T	probably damaging	Het
Phf3	A	T	1: 30,806,206	D1299E	probably damaging	Het
Pitx2	T	A	3: 129,218,754	Y271N	probably damaging	Het
Polk	T	C	13: 96,496,632	E301G	probably damaging	Het
Prkdc	C	A	16: 15,739,524	N2230K	probably damaging	Het
Prlr	A	G	15: 10,322,536	E170G	probably benign	Het
Prss55	A	G	14: 64,075,730	I235T	probably damaging	Het
Psd3	T	C	8: 67,960,565	I724V	probably benign	Het
Rabep2	A	G	7: 126,438,799	T248A	possibly damaging	Het
Rbm26	T	A	14: 105,117,073	K949N	probably benign	Het
Serpinb7	A	T	1: 107,450,273	H232L	possibly damaging	Het
Slu7	A	G	11: 43,445,242	Q484R	probably benign	Het
Smg1	A	G	7: 118,145,798	S3044P	possibly damaging	Het
Snrnp48	A	G	13: 38,221,360	D248G	possibly damaging	Het
Snrpc	C	A	17: 27,845,219	P66Q	unknown	Het
Snrpn	T	A	7: 59,983,459		probably benign	Het
Spag17	T	A	3: 99,939,356	S65R	possibly damaging	Het
Srsf6	C	A	2: 162,934,488		probably benign	Het
Stil	T	A	4: 115,041,782	M1203K	probably benign	Het
Syt17	T	C	7: 118,436,838	T106A	probably benign	Het
Tbx15	C	T	3: 99,352,246	Q478*	probably null	Het
Tg	A	T	15: 66,737,548	Q319L	probably benign	Het
Thada	A	G	17: 84,448,033	L243P	probably damaging	Het
Thada	G	T	17: 84,448,034	L243I	probably damaging	Het
Tnnt3	A	G	7: 142,512,364	R211G	probably damaging	Het
Togaram1	A	T	12: 65,002,635	Q1282L	possibly damaging	Het
Tpm3-rs7	T	G	14: 113,314,947	M91R	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Ttll7	T	G	3: 146,915,780	L378R	probably damaging	Het
Tyw1	T	G	5: 130,258,993	I22R	probably damaging	Het
Ubr3	T	C	2: 70,016,367	S1645P	possibly damaging	Het
Ubr4	T	C	4: 139,393,053	L263P	probably damaging	Het
Unc13c	T	C	9: 73,756,339	E1071G	possibly damaging	Het
Vmn2r44	G	T	7: 8,380,123	D157E	possibly damaging	Het
Vps16	C	T	2: 130,443,600	T821I	probably benign	Het
Washc4	T	C	10: 83,579,525	V793A	possibly damaging	Het
Wdr35	G	T	12: 8,977,435		probably null	Het
Zfp277	A	G	12: 40,364,085	F254L	probably benign	Het

Other mutations in Rnf213

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Rnf213	APN	11	119449343	missense	probably benign	0.00
IGL00961:Rnf213	APN	11	119440843	missense	possibly damaging	0.55
IGL01324:Rnf213	APN	11	119447237	missense	probably damaging	1.00
IGL01351:Rnf213	APN	11	119483118	missense	probably benign	0.25
IGL01403:Rnf213	APN	11	119443300	missense	probably damaging	1.00
IGL01704:Rnf213	APN	11	119449876	critical splice donor site	probably null
IGL01765:Rnf213	APN	11	119436352	missense	probably benign	0.00
IGL01803:Rnf213	APN	11	119441307	missense	probably damaging	1.00
IGL01804:Rnf213	APN	11	119442266	missense	probably damaging	1.00
IGL01900:Rnf213	APN	11	119443015	missense	probably benign	0.05
IGL01944:Rnf213	APN	11	119416457	missense	probably benign	0.01
IGL01982:Rnf213	APN	11	119443268	missense	probably damaging	1.00
IGL02008:Rnf213	APN	11	119418309	splice site	probably benign
IGL02084:Rnf213	APN	11	119445673	missense	probably benign	0.04
IGL02253:Rnf213	APN	11	119440650	missense	probably benign	0.03
IGL02254:Rnf213	APN	11	119480907	missense	possibly damaging	0.89
IGL02296:Rnf213	APN	11	119463336	missense	probably benign	0.01
IGL02531:Rnf213	APN	11	119436802	missense	probably benign
IGL02588:Rnf213	APN	11	119416536	missense	probably benign	0.30
IGL02615:Rnf213	APN	11	119440789	missense	probably damaging	0.96
IGL02805:Rnf213	APN	11	119435066	missense	probably damaging	0.99
IGL02887:Rnf213	APN	11	119427510	missense	probably damaging	1.00
IGL03001:Rnf213	APN	11	119479941	missense	probably damaging	1.00
IGL03035:Rnf213	APN	11	119445626	splice site	probably benign
IGL03057:Rnf213	APN	11	119441087	missense	probably damaging	1.00
IGL03148:Rnf213	APN	11	119465007	missense	probably damaging	1.00
IGL03308:Rnf213	APN	11	119474172	missense	probably benign	0.03
IGL03339:Rnf213	APN	11	119443004	missense	probably damaging	1.00
IGL03369:Rnf213	APN	11	119421468	missense	probably benign	0.34
attrition	UTSW	11	119430321	missense	possibly damaging	0.77
defame	UTSW	11	119430281	nonsense	probably null
Derogate	UTSW	11	119470210	missense	probably damaging	1.00
dinky	UTSW	11	119416458	missense	probably damaging	0.99
G1funyon_rnf213_024	UTSW	11	119434742	missense
Impugn	UTSW	11	119436823	nonsense	probably null
R4332_Rnf213_642	UTSW	11	119436676	missense	probably damaging	1.00
B6584:Rnf213	UTSW	11	119426069	missense	probably damaging	0.97
G1Funyon:Rnf213	UTSW	11	119434742	missense
PIT4585001:Rnf213	UTSW	11	119458392	missense
R0008:Rnf213	UTSW	11	119465052	missense	possibly damaging	0.82
R0015:Rnf213	UTSW	11	119441606	missense	possibly damaging	0.95
R0041:Rnf213	UTSW	11	119402575	missense	probably benign	0.41
R0114:Rnf213	UTSW	11	119414587	missense	probably damaging	1.00
R0131:Rnf213	UTSW	11	119430361	missense	probably benign	0.10
R0131:Rnf213	UTSW	11	119430361	missense	probably benign	0.10
R0132:Rnf213	UTSW	11	119430361	missense	probably benign	0.10
R0138:Rnf213	UTSW	11	119416496	missense	probably benign	0.05
R0144:Rnf213	UTSW	11	119479600	nonsense	probably null
R0184:Rnf213	UTSW	11	119414521	missense	probably damaging	0.99
R0321:Rnf213	UTSW	11	119438105	nonsense	probably null
R0365:Rnf213	UTSW	11	119426111	missense	possibly damaging	0.74
R0415:Rnf213	UTSW	11	119414469	missense	probably damaging	1.00
R0421:Rnf213	UTSW	11	119447257	missense	probably damaging	1.00
R0494:Rnf213	UTSW	11	119426012	missense	possibly damaging	0.65
R0494:Rnf213	UTSW	11	119443120	missense	probably damaging	1.00
R0549:Rnf213	UTSW	11	119465082	missense	probably damaging	1.00
R0577:Rnf213	UTSW	11	119443280	missense	probably damaging	1.00
R0605:Rnf213	UTSW	11	119431717	missense	probably benign	0.03
R0638:Rnf213	UTSW	11	119470210	missense	probably damaging	1.00
R0675:Rnf213	UTSW	11	119441834	missense	probably benign	0.28
R0715:Rnf213	UTSW	11	119441150	missense	probably damaging	0.97
R0732:Rnf213	UTSW	11	119441068	missense	probably damaging	0.99
R0748:Rnf213	UTSW	11	119473480	missense	probably damaging	1.00
R0765:Rnf213	UTSW	11	119423095	critical splice donor site	probably null
R0890:Rnf213	UTSW	11	119430486	missense	possibly damaging	0.94
R0927:Rnf213	UTSW	11	119414570	missense	probably benign	0.00
R0940:Rnf213	UTSW	11	119416563	missense	probably benign	0.10
R0959:Rnf213	UTSW	11	119452581	missense	probably damaging	0.99
R1077:Rnf213	UTSW	11	119485998	splice site	probably benign
R1104:Rnf213	UTSW	11	119477229	missense	probably benign	0.29
R1141:Rnf213	UTSW	11	119435983	missense	probably benign	0.02
R1219:Rnf213	UTSW	11	119436177	missense	probably damaging	1.00
R1435:Rnf213	UTSW	11	119436005	missense	probably damaging	1.00
R1444:Rnf213	UTSW	11	119442400	missense	probably damaging	1.00
R1474:Rnf213	UTSW	11	119437750	missense	probably damaging	1.00
R1488:Rnf213	UTSW	11	119480889	missense	probably benign	0.05
R1523:Rnf213	UTSW	11	119441888	missense	probably damaging	1.00
R1548:Rnf213	UTSW	11	119442707	missense	probably damaging	1.00
R1554:Rnf213	UTSW	11	119441839	missense	probably benign	0.06
R1563:Rnf213	UTSW	11	119414526	missense	probably benign	0.13
R1572:Rnf213	UTSW	11	119436611	missense	probably damaging	1.00
R1585:Rnf213	UTSW	11	119463345	missense	probably damaging	1.00
R1635:Rnf213	UTSW	11	119442579	missense	probably damaging	0.97
R1663:Rnf213	UTSW	11	119437672	missense	probably benign	0.01
R1844:Rnf213	UTSW	11	119441183	missense	probably damaging	1.00
R1871:Rnf213	UTSW	11	119450129	missense	probably benign	0.08
R1893:Rnf213	UTSW	11	119416448	missense	probably damaging	1.00
R1937:Rnf213	UTSW	11	119431685	missense	probably damaging	1.00
R1967:Rnf213	UTSW	11	119480895	missense	probably damaging	1.00
R1987:Rnf213	UTSW	11	119441107	missense	probably damaging	1.00
R2000:Rnf213	UTSW	11	119436022	missense	probably damaging	1.00
R2020:Rnf213	UTSW	11	119461918	missense	probably damaging	0.99
R2100:Rnf213	UTSW	11	119467302	nonsense	probably null
R2109:Rnf213	UTSW	11	119442663	nonsense	probably null
R2115:Rnf213	UTSW	11	119428013	missense	probably benign	0.00
R2126:Rnf213	UTSW	11	119450201	missense	probably damaging	0.99
R2144:Rnf213	UTSW	11	119443690	missense	probably damaging	0.99
R2145:Rnf213	UTSW	11	119415193	missense	probably benign	0.03
R2168:Rnf213	UTSW	11	119415070	missense	probably damaging	0.97
R2189:Rnf213	UTSW	11	119430361	missense	probably benign	0.10
R2199:Rnf213	UTSW	11	119460009	missense	probably benign	0.01
R2220:Rnf213	UTSW	11	119436428	missense	possibly damaging	0.94
R2336:Rnf213	UTSW	11	119414604	missense	probably benign	0.02
R2400:Rnf213	UTSW	11	119443195	missense	probably damaging	1.00
R2679:Rnf213	UTSW	11	119459938	splice site	probably null
R2698:Rnf213	UTSW	11	119410144	missense	probably benign	0.26
R3151:Rnf213	UTSW	11	119468892	missense	probably benign	0.03
R3607:Rnf213	UTSW	11	119441976	nonsense	probably null
R3808:Rnf213	UTSW	11	119479558	missense	probably damaging	1.00
R3854:Rnf213	UTSW	11	119480939	splice site	probably benign
R3856:Rnf213	UTSW	11	119480939	splice site	probably benign
R3973:Rnf213	UTSW	11	119469053	missense
R4014:Rnf213	UTSW	11	119445729	nonsense	probably null
R4049:Rnf213	UTSW	11	119482448	missense	possibly damaging	0.67
R4130:Rnf213	UTSW	11	119483006	missense	probably damaging	1.00
R4153:Rnf213	UTSW	11	119409482	missense	probably benign	0.27
R4167:Rnf213	UTSW	11	119441243	missense	probably damaging	0.99
R4224:Rnf213	UTSW	11	119436823	nonsense	probably null
R4332:Rnf213	UTSW	11	119436676	missense	probably damaging	1.00
R4415:Rnf213	UTSW	11	119483964	missense	probably damaging	0.99
R4547:Rnf213	UTSW	11	119479670	critical splice donor site	probably null
R4609:Rnf213	UTSW	11	119437695	missense	possibly damaging	0.86
R4684:Rnf213	UTSW	11	119441125	missense	probably damaging	1.00
R4704:Rnf213	UTSW	11	119440349	missense	probably damaging	1.00
R4719:Rnf213	UTSW	11	119420067	missense	probably benign	0.38
R4751:Rnf213	UTSW	11	119445745	missense	probably benign	0.12
R4828:Rnf213	UTSW	11	119416629	missense	possibly damaging	0.61
R4837:Rnf213	UTSW	11	119442763	missense	probably benign	0.00
R4894:Rnf213	UTSW	11	119481240	missense	probably damaging	1.00
R4973:Rnf213	UTSW	11	119428157	missense	possibly damaging	0.84
R5026:Rnf213	UTSW	11	119436764	missense	probably damaging	1.00
R5034:Rnf213	UTSW	11	119410807	missense	probably damaging	0.99
R5284:Rnf213	UTSW	11	119458866	missense	possibly damaging	0.89
R5295:Rnf213	UTSW	11	119440816	missense	probably benign	0.00
R5406:Rnf213	UTSW	11	119440808	missense	probably damaging	1.00
R5441:Rnf213	UTSW	11	119409020	missense	probably damaging	0.99
R5449:Rnf213	UTSW	11	119415076	missense	probably benign	0.44
R5520:Rnf213	UTSW	11	119433499	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119436629	missense	probably benign	0.04
R5636:Rnf213	UTSW	11	119436905	missense	probably damaging	1.00
R5669:Rnf213	UTSW	11	119458785	missense	possibly damaging	0.92
R5670:Rnf213	UTSW	11	119434686	critical splice acceptor site	probably null
R5697:Rnf213	UTSW	11	119483894	missense	possibly damaging	0.54
R5726:Rnf213	UTSW	11	119416458	missense	probably damaging	0.99
R5808:Rnf213	UTSW	11	119436295	missense	probably benign
R5861:Rnf213	UTSW	11	119473377	missense	probably damaging	1.00
R5903:Rnf213	UTSW	11	119421369	missense	probably damaging	0.98
R5949:Rnf213	UTSW	11	119443079	missense	probably damaging	1.00
R6022:Rnf213	UTSW	11	119486010	missense	probably benign	0.00
R6043:Rnf213	UTSW	11	119442101	missense	probably damaging	0.97
R6089:Rnf213	UTSW	11	119416559	missense	probably benign	0.14
R6123:Rnf213	UTSW	11	119411513	missense	probably damaging	0.96
R6134:Rnf213	UTSW	11	119411470	missense	probably damaging	0.99
R6135:Rnf213	UTSW	11	119442028	missense	probably benign	0.02
R6146:Rnf213	UTSW	11	119435999	missense	probably benign	0.41
R6163:Rnf213	UTSW	11	119458428	missense	possibly damaging	0.86
R6272:Rnf213	UTSW	11	119414548	missense	probably damaging	1.00
R6333:Rnf213	UTSW	11	119463366	missense	probably damaging	1.00
R6370:Rnf213	UTSW	11	119477078	missense	probably damaging	0.99
R6456:Rnf213	UTSW	11	119459966	missense	probably benign	0.03
R6468:Rnf213	UTSW	11	119452687	missense	possibly damaging	0.94
R6579:Rnf213	UTSW	11	119436280	missense	probably damaging	0.96
R6648:Rnf213	UTSW	11	119479920	missense	possibly damaging	0.81
R6727:Rnf213	UTSW	11	119430321	missense	possibly damaging	0.77
R6739:Rnf213	UTSW	11	119442271	missense	probably damaging	1.00
R6768:Rnf213	UTSW	11	119442236	missense	probably damaging	0.99
R6817:Rnf213	UTSW	11	119462285	critical splice donor site	probably null
R6820:Rnf213	UTSW	11	119448838	missense	probably damaging	1.00
R6841:Rnf213	UTSW	11	119449866	missense	probably benign	0.26
R6934:Rnf213	UTSW	11	119420067	missense	probably benign	0.38
R7026:Rnf213	UTSW	11	119479655	missense	possibly damaging	0.58
R7094:Rnf213	UTSW	11	119437604	splice site	probably null
R7170:Rnf213	UTSW	11	119452575	missense
R7185:Rnf213	UTSW	11	119424198	missense
R7239:Rnf213	UTSW	11	119458788	missense
R7258:Rnf213	UTSW	11	119452575	missense
R7259:Rnf213	UTSW	11	119452575	missense
R7260:Rnf213	UTSW	11	119452575	missense
R7273:Rnf213	UTSW	11	119431756	splice site	probably null
R7282:Rnf213	UTSW	11	119437992	missense
R7311:Rnf213	UTSW	11	119416547	missense
R7352:Rnf213	UTSW	11	119443579	missense
R7369:Rnf213	UTSW	11	119430468	missense
R7410:Rnf213	UTSW	11	119435051	missense
R7448:Rnf213	UTSW	11	119481291	missense
R7561:Rnf213	UTSW	11	119441719	missense
R7573:Rnf213	UTSW	11	119458484	missense
R7615:Rnf213	UTSW	11	119467297	missense
R7680:Rnf213	UTSW	11	119479556	missense
R7739:Rnf213	UTSW	11	119410861	missense
R7789:Rnf213	UTSW	11	119470219	splice site	probably null
R7806:Rnf213	UTSW	11	119411545	missense
R8031:Rnf213	UTSW	11	119430281	nonsense	probably null
R8042:Rnf213	UTSW	11	119441654	missense
R8053:Rnf213	UTSW	11	119402647	missense
R8284:Rnf213	UTSW	11	119428083	missense
R8301:Rnf213	UTSW	11	119434742	missense
R8325:Rnf213	UTSW	11	119430445	missense
R8332:Rnf213	UTSW	11	119483698	missense
R8443:Rnf213	UTSW	11	119449323	missense
R8518:Rnf213	UTSW	11	119462217	missense
R8531:Rnf213	UTSW	11	119474205	missense	probably benign	0.02
R8670:Rnf213	UTSW	11	119458737	missense
R8675:Rnf213	UTSW	11	119456158	missense
R8690:Rnf213	UTSW	11	119418129	missense
R8690:Rnf213	UTSW	11	119441212	missense
R8714:Rnf213	UTSW	11	119468894	missense
R8802:Rnf213	UTSW	11	119462102	missense
R8861:Rnf213	UTSW	11	119442236	missense
R8886:Rnf213	UTSW	11	119473438	missense
R8893:Rnf213	UTSW	11	119443042	missense
R8937:Rnf213	UTSW	11	119430274	missense	possibly damaging	0.94
R8941:Rnf213	UTSW	11	119414424	missense	probably damaging	1.00
R8973:Rnf213	UTSW	11	119461930	missense
R8983:Rnf213	UTSW	11	119430349	missense
R9043:Rnf213	UTSW	11	119458913	missense
R9081:Rnf213	UTSW	11	119466236	missense
R9132:Rnf213	UTSW	11	119483916	missense
R9135:Rnf213	UTSW	11	119408747	missense
R9146:Rnf213	UTSW	11	119443673	missense
R9156:Rnf213	UTSW	11	119440748	missense
R9183:Rnf213	UTSW	11	119427622	missense
R9234:Rnf213	UTSW	11	119450117	missense
R9275:Rnf213	UTSW	11	119435942	missense
R9278:Rnf213	UTSW	11	119435942	missense
R9296:Rnf213	UTSW	11	119443795	splice site	probably benign
R9350:Rnf213	UTSW	11	119442149	missense
R9366:Rnf213	UTSW	11	119436231	missense
R9413:Rnf213	UTSW	11	119466233	missense
R9444:Rnf213	UTSW	11	119434797	missense
R9464:Rnf213	UTSW	11	119463580	missense
R9605:Rnf213	UTSW	11	119469053	missense
R9649:Rnf213	UTSW	11	119479631	missense
R9651:Rnf213	UTSW	11	119440412	missense
R9664:Rnf213	UTSW	11	119441968	missense
R9696:Rnf213	UTSW	11	119468980	missense
R9710:Rnf213	UTSW	11	119441005	missense
R9797:Rnf213	UTSW	11	119442539	missense
S24628:Rnf213	UTSW	11	119414469	missense	probably damaging	1.00
X0021:Rnf213	UTSW	11	119441824	missense	probably benign	0.14
X0062:Rnf213	UTSW	11	119473513	missense	probably benign	0.05
X0064:Rnf213	UTSW	11	119440463	missense	probably damaging	1.00
Z1088:Rnf213	UTSW	11	119477254	missense	possibly damaging	0.69
Z1176:Rnf213	UTSW	11	119441410	missense
Z1176:Rnf213	UTSW	11	119482998	missense

Predicted Primers

PCR Primer
(F):5'- GCCCTTGATTGTGTTAGAAAATGC -3'
(R):5'- TGAAATGTGTCCAGGTTCTGC -3'

Sequencing Primer
(F):5'- ATTTAGTTCTCTAAACCCTTAGCAGG -3'
(R):5'- GCTGCTGATGGAACCGTTTTAAATAC -3'

Posted On

2014-06-23