Incidental Mutation 'R1789:Rnf213'
ID201645
Institutional Source Beutler Lab
Gene Symbol Rnf213
Ensembl Gene ENSMUSG00000070327
Gene Namering finger protein 213
SynonymsD11Ertd759e
MMRRC Submission 039820-MU
Accession Numbers

Genbank: XM_001477846.2; Ensembl: ENSMUST00000131035, ENSMUST00000082107, ENSMUST00000093902, ENSMUST00000169768, ENSMUST00000172235

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1789 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location119393100-119487418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119440221 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 2085 (D2085E)
Ref Sequence ENSEMBL: ENSMUSP00000115063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093902
AA Change: D2086E

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: D2086E

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1546 1558 N/A INTRINSIC
AAA 2373 2515 2.82e-2 SMART
AAA 2722 2890 3.63e-1 SMART
low complexity region 3449 3459 N/A INTRINSIC
RING 3947 3985 8.69e-5 SMART
Blast:PP2Ac 4544 4722 3e-66 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000131035
AA Change: D2085E

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: D2085E

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1113 1127 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
AAA 2372 2514 2.82e-2 SMART
AAA 2721 2889 3.63e-1 SMART
low complexity region 3448 3458 N/A INTRINSIC
RING 3946 3984 8.69e-5 SMART
Blast:PP2Ac 4542 4720 3e-66 BLAST
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G A 16: 20,365,951 P986L probably damaging Het
Acad10 A T 5: 121,631,393 Y667N possibly damaging Het
Ahi1 G A 10: 20,963,115 G121D probably benign Het
Ampd1 T A 3: 103,099,126 I690N possibly damaging Het
Amy1 C A 3: 113,558,165 W425L possibly damaging Het
Arhgap27 A T 11: 103,333,005 V823E probably damaging Het
Arhgef17 A G 7: 100,929,870 S624P probably damaging Het
Arid5b T C 10: 68,186,067 H231R probably damaging Het
Aspscr1 C A 11: 120,688,560 T78N probably damaging Het
Auts2 T A 5: 131,472,450 T42S probably damaging Het
Ccdc171 A G 4: 83,554,808 D158G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap61 T C 2: 145,939,993 probably null Het
Chrna5 T C 9: 55,004,651 V245A possibly damaging Het
Cntnap5c G A 17: 58,013,921 G163R probably damaging Het
Col5a2 A G 1: 45,378,305 probably null Het
Col5a2 T C 1: 45,394,776 Q759R probably damaging Het
Comp A G 8: 70,377,146 D340G probably benign Het
Cyfip1 T A 7: 55,926,395 D1104E probably damaging Het
Dnah11 A T 12: 118,038,780 S308T probably damaging Het
Dnah5 A G 15: 28,270,426 H958R probably benign Het
Elp3 A G 14: 65,547,919 Y478H probably damaging Het
Fat3 T C 9: 16,376,985 Y414C probably benign Het
Fbxo10 C A 4: 45,046,389 A574S probably damaging Het
Fsip2 G T 2: 82,977,562 L1408F probably benign Het
Fubp3 T C 2: 31,611,735 V425A possibly damaging Het
Gm7168 A T 17: 13,949,584 R404S probably benign Het
Gm8773 A T 5: 5,575,652 Q116L possibly damaging Het
Gpd1 T G 15: 99,723,202 F299C probably damaging Het
Gpr137 C T 19: 6,942,057 probably benign Het
Grin3b T C 10: 79,973,408 S331P probably benign Het
Grk3 T A 5: 112,941,718 I281F probably damaging Het
Hoxb7 T A 11: 96,286,781 S18R probably damaging Het
Igf1r C T 7: 68,214,933 R1160* probably null Het
Itfg1 A G 8: 85,725,512 probably null Het
Itgb8 T C 12: 119,202,455 I114V probably benign Het
Kcnk1 A G 8: 126,025,384 E243G possibly damaging Het
Kif27 A G 13: 58,344,008 L439P probably damaging Het
Kif2c T A 4: 117,167,361 Q279L probably benign Het
Kmt2d A T 15: 98,852,074 probably benign Het
L3mbtl1 A G 2: 162,974,502 T821A probably benign Het
Lrrc24 A T 15: 76,722,578 M206K probably benign Het
Mamdc4 T G 2: 25,567,622 K460Q possibly damaging Het
Maml2 C G 9: 13,697,345 L30V probably damaging Het
Mc5r C G 18: 68,338,670 probably null Het
Myo10 T G 15: 25,726,525 probably null Het
Myo1e T A 9: 70,338,784 L419Q probably damaging Het
Myo6 C A 9: 80,300,572 H1115Q probably damaging Het
Myo7a A G 7: 98,107,095 V10A probably damaging Het
Myoz2 C T 3: 123,026,127 R61H probably damaging Het
Ncdn G A 4: 126,752,003 R38C probably damaging Het
Nckap1 T A 2: 80,520,556 T736S probably benign Het
Ncor2 G A 5: 125,019,890 A2325V probably damaging Het
Nid2 T A 14: 19,752,431 V140E possibly damaging Het
Nlrp9c C A 7: 26,380,490 D704Y probably benign Het
Notch3 T A 17: 32,158,725 S126C probably damaging Het
Olfr1128 A T 2: 87,544,983 L187H probably damaging Het
Olfr130 T C 17: 38,067,948 I259T probably damaging Het
Olfr215 A C 6: 116,582,697 F83C probably damaging Het
Olfr484 A G 7: 108,124,915 F116S probably benign Het
Olfr804 T C 10: 129,705,607 M243T possibly damaging Het
Olfr818 A T 10: 129,945,582 L160* probably null Het
Pdzd7 A G 19: 45,039,228 I269T probably damaging Het
Phf3 A T 1: 30,806,206 D1299E probably damaging Het
Pitx2 T A 3: 129,218,754 Y271N probably damaging Het
Polk T C 13: 96,496,632 E301G probably damaging Het
Prkdc C A 16: 15,739,524 N2230K probably damaging Het
Prlr A G 15: 10,322,536 E170G probably benign Het
Prss55 A G 14: 64,075,730 I235T probably damaging Het
Psd3 T C 8: 67,960,565 I724V probably benign Het
Rabep2 A G 7: 126,438,799 T248A possibly damaging Het
Rbm26 T A 14: 105,117,073 K949N probably benign Het
Serpinb7 A T 1: 107,450,273 H232L possibly damaging Het
Slu7 A G 11: 43,445,242 Q484R probably benign Het
Smg1 A G 7: 118,145,798 S3044P possibly damaging Het
Snrnp48 A G 13: 38,221,360 D248G possibly damaging Het
Snrpc C A 17: 27,845,219 P66Q unknown Het
Snrpn T A 7: 59,983,459 probably benign Het
Spag17 T A 3: 99,939,356 S65R possibly damaging Het
Srsf6 C A 2: 162,934,488 probably benign Het
Stil T A 4: 115,041,782 M1203K probably benign Het
Syt17 T C 7: 118,436,838 T106A probably benign Het
Tbx15 C T 3: 99,352,246 Q478* probably null Het
Tg A T 15: 66,737,548 Q319L probably benign Het
Thada A G 17: 84,448,033 L243P probably damaging Het
Thada G T 17: 84,448,034 L243I probably damaging Het
Tnnt3 A G 7: 142,512,364 R211G probably damaging Het
Togaram1 A T 12: 65,002,635 Q1282L possibly damaging Het
Tpm3-rs7 T G 14: 113,314,947 M91R probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Ttll7 T G 3: 146,915,780 L378R probably damaging Het
Tyw1 T G 5: 130,258,993 I22R probably damaging Het
Ubr3 T C 2: 70,016,367 S1645P possibly damaging Het
Ubr4 T C 4: 139,393,053 L263P probably damaging Het
Unc13c T C 9: 73,756,339 E1071G possibly damaging Het
Vmn2r44 G T 7: 8,380,123 D157E possibly damaging Het
Vps16 C T 2: 130,443,600 T821I probably benign Het
Washc4 T C 10: 83,579,525 V793A possibly damaging Het
Wdr35 G T 12: 8,977,435 probably null Het
Zfp277 A G 12: 40,364,085 F254L probably benign Het
Other mutations in Rnf213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rnf213 APN 11 119449343 missense probably benign 0.00
IGL00961:Rnf213 APN 11 119440843 missense possibly damaging 0.55
IGL01324:Rnf213 APN 11 119447237 missense probably damaging 1.00
IGL01351:Rnf213 APN 11 119483118 missense probably benign 0.25
IGL01403:Rnf213 APN 11 119443300 missense probably damaging 1.00
IGL01704:Rnf213 APN 11 119449876 critical splice donor site probably null
IGL01765:Rnf213 APN 11 119436352 missense probably benign 0.00
IGL01803:Rnf213 APN 11 119441307 missense probably damaging 1.00
IGL01804:Rnf213 APN 11 119442266 missense probably damaging 1.00
IGL01900:Rnf213 APN 11 119443015 missense probably benign 0.05
IGL01944:Rnf213 APN 11 119416457 missense probably benign 0.01
IGL01982:Rnf213 APN 11 119443268 missense probably damaging 1.00
IGL02008:Rnf213 APN 11 119418309 splice site probably benign
IGL02084:Rnf213 APN 11 119445673 missense probably benign 0.04
IGL02253:Rnf213 APN 11 119440650 missense probably benign 0.03
IGL02254:Rnf213 APN 11 119480907 missense possibly damaging 0.89
IGL02296:Rnf213 APN 11 119463336 missense probably benign 0.01
IGL02531:Rnf213 APN 11 119436802 missense probably benign
IGL02588:Rnf213 APN 11 119416536 missense probably benign 0.30
IGL02615:Rnf213 APN 11 119440789 missense probably damaging 0.96
IGL02805:Rnf213 APN 11 119435066 missense probably damaging 0.99
IGL02887:Rnf213 APN 11 119427510 missense probably damaging 1.00
IGL03001:Rnf213 APN 11 119479941 missense probably damaging 1.00
IGL03035:Rnf213 APN 11 119445626 splice site probably benign
IGL03057:Rnf213 APN 11 119441087 missense probably damaging 1.00
IGL03148:Rnf213 APN 11 119465007 missense probably damaging 1.00
IGL03308:Rnf213 APN 11 119474172 missense probably benign 0.03
IGL03339:Rnf213 APN 11 119443004 missense probably damaging 1.00
IGL03369:Rnf213 APN 11 119421468 missense probably benign 0.34
attrition UTSW 11 119430321 missense possibly damaging 0.77
defame UTSW 11 119430281 nonsense probably null
Derogate UTSW 11 119470210 missense probably damaging 1.00
dinky UTSW 11 119416458 missense probably damaging 0.99
Impugn UTSW 11 119436823 nonsense probably null
B6584:Rnf213 UTSW 11 119426069 missense probably damaging 0.97
PIT4585001:Rnf213 UTSW 11 119458392 missense
R0008:Rnf213 UTSW 11 119465052 missense possibly damaging 0.82
R0015:Rnf213 UTSW 11 119441606 missense possibly damaging 0.95
R0041:Rnf213 UTSW 11 119402575 missense probably benign 0.41
R0114:Rnf213 UTSW 11 119414587 missense probably damaging 1.00
R0131:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0131:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0132:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R0138:Rnf213 UTSW 11 119416496 missense probably benign 0.05
R0144:Rnf213 UTSW 11 119479600 nonsense probably null
R0184:Rnf213 UTSW 11 119414521 missense probably damaging 0.99
R0321:Rnf213 UTSW 11 119438105 nonsense probably null
R0365:Rnf213 UTSW 11 119426111 missense possibly damaging 0.74
R0415:Rnf213 UTSW 11 119414469 missense probably damaging 1.00
R0421:Rnf213 UTSW 11 119447257 missense probably damaging 1.00
R0494:Rnf213 UTSW 11 119426012 missense possibly damaging 0.65
R0494:Rnf213 UTSW 11 119443120 missense probably damaging 1.00
R0549:Rnf213 UTSW 11 119465082 missense probably damaging 1.00
R0577:Rnf213 UTSW 11 119443280 missense probably damaging 1.00
R0605:Rnf213 UTSW 11 119431717 missense probably benign 0.03
R0638:Rnf213 UTSW 11 119470210 missense probably damaging 1.00
R0675:Rnf213 UTSW 11 119441834 missense probably benign 0.28
R0715:Rnf213 UTSW 11 119441150 missense probably damaging 0.97
R0732:Rnf213 UTSW 11 119441068 missense probably damaging 0.99
R0748:Rnf213 UTSW 11 119473480 missense probably damaging 1.00
R0765:Rnf213 UTSW 11 119423095 critical splice donor site probably null
R0890:Rnf213 UTSW 11 119430486 missense possibly damaging 0.94
R0927:Rnf213 UTSW 11 119414570 missense probably benign 0.00
R0940:Rnf213 UTSW 11 119416563 missense probably benign 0.10
R0959:Rnf213 UTSW 11 119452581 missense probably damaging 0.99
R1077:Rnf213 UTSW 11 119485998 splice site probably benign
R1104:Rnf213 UTSW 11 119477229 missense probably benign 0.29
R1141:Rnf213 UTSW 11 119435983 missense probably benign 0.02
R1219:Rnf213 UTSW 11 119436177 missense probably damaging 1.00
R1435:Rnf213 UTSW 11 119436005 missense probably damaging 1.00
R1444:Rnf213 UTSW 11 119442400 missense probably damaging 1.00
R1474:Rnf213 UTSW 11 119437750 missense probably damaging 1.00
R1488:Rnf213 UTSW 11 119480889 missense probably benign 0.05
R1523:Rnf213 UTSW 11 119441888 missense probably damaging 1.00
R1548:Rnf213 UTSW 11 119442707 missense probably damaging 1.00
R1554:Rnf213 UTSW 11 119441839 missense probably benign 0.06
R1563:Rnf213 UTSW 11 119414526 missense probably benign 0.13
R1572:Rnf213 UTSW 11 119436611 missense probably damaging 1.00
R1585:Rnf213 UTSW 11 119463345 missense probably damaging 1.00
R1635:Rnf213 UTSW 11 119442579 missense probably damaging 0.97
R1663:Rnf213 UTSW 11 119437672 missense probably benign 0.01
R1844:Rnf213 UTSW 11 119441183 missense probably damaging 1.00
R1871:Rnf213 UTSW 11 119450129 missense probably benign 0.08
R1893:Rnf213 UTSW 11 119416448 missense probably damaging 1.00
R1937:Rnf213 UTSW 11 119431685 missense probably damaging 1.00
R1967:Rnf213 UTSW 11 119480895 missense probably damaging 1.00
R1987:Rnf213 UTSW 11 119441107 missense probably damaging 1.00
R2000:Rnf213 UTSW 11 119436022 missense probably damaging 1.00
R2020:Rnf213 UTSW 11 119461918 missense probably damaging 0.99
R2100:Rnf213 UTSW 11 119467302 nonsense probably null
R2109:Rnf213 UTSW 11 119442663 nonsense probably null
R2115:Rnf213 UTSW 11 119428013 missense probably benign 0.00
R2126:Rnf213 UTSW 11 119450201 missense probably damaging 0.99
R2144:Rnf213 UTSW 11 119443690 missense probably damaging 0.99
R2145:Rnf213 UTSW 11 119415193 missense probably benign 0.03
R2168:Rnf213 UTSW 11 119415070 missense probably damaging 0.97
R2189:Rnf213 UTSW 11 119430361 missense probably benign 0.10
R2199:Rnf213 UTSW 11 119460009 missense probably benign 0.01
R2220:Rnf213 UTSW 11 119436428 missense possibly damaging 0.94
R2336:Rnf213 UTSW 11 119414604 missense probably benign 0.02
R2400:Rnf213 UTSW 11 119443195 missense probably damaging 1.00
R2679:Rnf213 UTSW 11 119459938 splice site probably null
R2698:Rnf213 UTSW 11 119410144 missense probably benign 0.26
R3151:Rnf213 UTSW 11 119468892 missense probably benign 0.03
R3607:Rnf213 UTSW 11 119441976 nonsense probably null
R3808:Rnf213 UTSW 11 119479558 missense probably damaging 1.00
R3854:Rnf213 UTSW 11 119480939 splice site probably benign
R3856:Rnf213 UTSW 11 119480939 splice site probably benign
R3973:Rnf213 UTSW 11 119469053 missense probably benign 0.27
R4014:Rnf213 UTSW 11 119445729 nonsense probably null
R4049:Rnf213 UTSW 11 119482448 missense possibly damaging 0.67
R4130:Rnf213 UTSW 11 119483006 missense probably damaging 1.00
R4153:Rnf213 UTSW 11 119409482 missense probably benign 0.27
R4167:Rnf213 UTSW 11 119441243 missense probably damaging 0.99
R4224:Rnf213 UTSW 11 119436823 nonsense probably null
R4332:Rnf213 UTSW 11 119436676 missense probably damaging 1.00
R4415:Rnf213 UTSW 11 119483964 missense probably damaging 0.99
R4547:Rnf213 UTSW 11 119479670 critical splice donor site probably null
R4609:Rnf213 UTSW 11 119437695 missense possibly damaging 0.86
R4684:Rnf213 UTSW 11 119441125 missense probably damaging 1.00
R4704:Rnf213 UTSW 11 119440349 missense probably damaging 1.00
R4719:Rnf213 UTSW 11 119420067 missense probably benign 0.38
R4751:Rnf213 UTSW 11 119445745 missense probably benign 0.12
R4828:Rnf213 UTSW 11 119416629 missense possibly damaging 0.61
R4837:Rnf213 UTSW 11 119442763 missense probably benign 0.00
R4894:Rnf213 UTSW 11 119481240 missense probably damaging 1.00
R4973:Rnf213 UTSW 11 119428157 missense possibly damaging 0.84
R5026:Rnf213 UTSW 11 119436764 missense probably damaging 1.00
R5034:Rnf213 UTSW 11 119410807 missense probably damaging 0.99
R5284:Rnf213 UTSW 11 119458866 missense possibly damaging 0.89
R5295:Rnf213 UTSW 11 119440816 missense probably benign 0.00
R5406:Rnf213 UTSW 11 119440808 missense probably damaging 1.00
R5441:Rnf213 UTSW 11 119409020 missense probably damaging 0.99
R5449:Rnf213 UTSW 11 119415076 missense probably benign 0.44
R5520:Rnf213 UTSW 11 119433499 missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119436629 missense probably benign 0.04
R5636:Rnf213 UTSW 11 119436905 missense probably damaging 1.00
R5669:Rnf213 UTSW 11 119458785 missense possibly damaging 0.92
R5670:Rnf213 UTSW 11 119434686 critical splice acceptor site probably null
R5697:Rnf213 UTSW 11 119483894 missense possibly damaging 0.54
R5726:Rnf213 UTSW 11 119416458 missense probably damaging 0.99
R5808:Rnf213 UTSW 11 119436295 missense probably benign
R5861:Rnf213 UTSW 11 119473377 missense probably damaging 1.00
R5903:Rnf213 UTSW 11 119421369 missense probably damaging 0.98
R5949:Rnf213 UTSW 11 119443079 missense probably damaging 1.00
R6022:Rnf213 UTSW 11 119486010 missense probably benign 0.00
R6043:Rnf213 UTSW 11 119442101 missense probably damaging 0.97
R6089:Rnf213 UTSW 11 119416559 missense probably benign 0.14
R6123:Rnf213 UTSW 11 119411513 missense probably damaging 0.96
R6134:Rnf213 UTSW 11 119411470 missense probably damaging 0.99
R6135:Rnf213 UTSW 11 119442028 missense probably benign 0.02
R6146:Rnf213 UTSW 11 119435999 missense probably benign 0.41
R6163:Rnf213 UTSW 11 119458428 missense possibly damaging 0.86
R6272:Rnf213 UTSW 11 119414548 missense probably damaging 1.00
R6333:Rnf213 UTSW 11 119463366 missense probably damaging 1.00
R6370:Rnf213 UTSW 11 119477078 missense probably damaging 0.99
R6456:Rnf213 UTSW 11 119459966 missense probably benign 0.03
R6468:Rnf213 UTSW 11 119452687 missense possibly damaging 0.94
R6579:Rnf213 UTSW 11 119436280 missense probably damaging 0.96
R6648:Rnf213 UTSW 11 119479920 missense possibly damaging 0.81
R6727:Rnf213 UTSW 11 119430321 missense possibly damaging 0.77
R6739:Rnf213 UTSW 11 119442271 missense probably damaging 1.00
R6768:Rnf213 UTSW 11 119442236 missense probably damaging 0.99
R6817:Rnf213 UTSW 11 119462285 critical splice donor site probably null
R6820:Rnf213 UTSW 11 119448838 missense probably damaging 1.00
R6841:Rnf213 UTSW 11 119449866 missense probably benign 0.26
R6934:Rnf213 UTSW 11 119420067 missense probably benign 0.38
R7026:Rnf213 UTSW 11 119479655 missense possibly damaging 0.58
R7094:Rnf213 UTSW 11 119437604 splice site probably null
R7170:Rnf213 UTSW 11 119452575 missense
R7185:Rnf213 UTSW 11 119424198 missense
R7239:Rnf213 UTSW 11 119458788 missense
R7258:Rnf213 UTSW 11 119452575 missense
R7259:Rnf213 UTSW 11 119452575 missense
R7260:Rnf213 UTSW 11 119452575 missense
R7273:Rnf213 UTSW 11 119431756 splice site probably null
R7282:Rnf213 UTSW 11 119437992 missense
R7311:Rnf213 UTSW 11 119416547 missense
R7352:Rnf213 UTSW 11 119443579 missense
R7369:Rnf213 UTSW 11 119430468 missense
R7410:Rnf213 UTSW 11 119435051 missense
R7448:Rnf213 UTSW 11 119481291 missense
R7561:Rnf213 UTSW 11 119441719 missense
R7573:Rnf213 UTSW 11 119458484 missense
R7615:Rnf213 UTSW 11 119467297 missense
R7680:Rnf213 UTSW 11 119479556 missense
R7739:Rnf213 UTSW 11 119410861 missense
R7789:Rnf213 UTSW 11 119470219 splice site probably null
R7806:Rnf213 UTSW 11 119411545 missense
R8031:Rnf213 UTSW 11 119430281 nonsense probably null
R8042:Rnf213 UTSW 11 119441654 missense
R8053:Rnf213 UTSW 11 119402647 missense
R8284:Rnf213 UTSW 11 119428083 missense
R8301:Rnf213 UTSW 11 119434742 missense
R8325:Rnf213 UTSW 11 119430445 missense
R8332:Rnf213 UTSW 11 119483698 missense
R8443:Rnf213 UTSW 11 119449323 missense
R8518:Rnf213 UTSW 11 119462217 missense
R8531:Rnf213 UTSW 11 119474205 missense probably benign 0.02
R8670:Rnf213 UTSW 11 119458737 missense
R8675:Rnf213 UTSW 11 119456158 missense
R8690:Rnf213 UTSW 11 119418129 missense
R8690:Rnf213 UTSW 11 119441212 missense
R8714:Rnf213 UTSW 11 119468894 missense
R8802:Rnf213 UTSW 11 119462102 missense
S24628:Rnf213 UTSW 11 119414469 missense probably damaging 1.00
X0021:Rnf213 UTSW 11 119441824 missense probably benign 0.14
X0062:Rnf213 UTSW 11 119473513 missense probably benign 0.05
X0064:Rnf213 UTSW 11 119440463 missense probably damaging 1.00
Z1088:Rnf213 UTSW 11 119477254 missense possibly damaging 0.69
Z1176:Rnf213 UTSW 11 119441410 missense
Z1176:Rnf213 UTSW 11 119482998 missense
Predicted Primers PCR Primer
(F):5'- GCCCTTGATTGTGTTAGAAAATGC -3'
(R):5'- TGAAATGTGTCCAGGTTCTGC -3'

Sequencing Primer
(F):5'- ATTTAGTTCTCTAAACCCTTAGCAGG -3'
(R):5'- GCTGCTGATGGAACCGTTTTAAATAC -3'
Posted On2014-06-23