Mutagenetix > Incidental Mutation

Incidental Mutation 'R1789:Polk'

201656

Institutional Source

Beutler Lab

Gene Symbol

Polk

Ensembl Gene

ENSMUSG00000021668

Gene Name

polymerase (DNA directed), kappa

Synonyms

Dinb1

MMRRC Submission

039820-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.190) question?

Stock #

R1789 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

96480690-96542579 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 96496632 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 301 (E301G)

Ref Sequence

ENSEMBL: ENSMUSP00000022172 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022172] [ENSMUST00000091387] [ENSMUST00000220977] [ENSMUST00000221645] [ENSMUST00000221899] [ENSMUST00000222075] [ENSMUST00000222143] [ENSMUST00000222389]

AlphaFold

Q9QUG2

PDB Structure

Solution structure of the mouse Rev1 CTD in complex with the Rev1-interacting Region (RIR)of Pol Kappa [SOLUTION NMR]
Structure of the Rev1 CTD-Rev3/7-Pol kappa RIR complex [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022172
AA Change: E301G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000022172
Gene: ENSMUSG00000021668
AA Change: E301G

Domain	Start	End	E-Value	Type
Pfam:IMS	105	324	1.7e-47	PFAM
Pfam:IMS_C	406	525	5.5e-22	PFAM
PDB:2LSJ\|B	559	582	9e-8	PDB
ZnF_Rad18	619	645	2.89e-9	SMART
ZnF_Rad18	761	787	2.31e-8	SMART
low complexity region	828	839	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000091387

SMART Domains

Protein: ENSMUSP00000088950
Gene: ENSMUSG00000021668

Domain	Start	End	E-Value	Type
Pfam:IMS	105	265	1.1e-37	PFAM
Pfam:IMS_C	346	469	8.8e-19	PFAM
PDB:2LSJ\|B	500	523	9e-8	PDB
ZnF_Rad18	560	586	2.89e-9	SMART
ZnF_Rad18	702	728	2.31e-8	SMART
low complexity region	769	780	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000220977

Predicted Effect

possibly damaging
Transcript: ENSMUST00000221645
AA Change: E301G

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000221899

Predicted Effect

probably benign
Transcript: ENSMUST00000222075

Predicted Effect

probably benign
Transcript: ENSMUST00000222143

Predicted Effect

probably benign
Transcript: ENSMUST00000222389

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA polymerase type-Y family of proteins. The encoded protein is a specialized DNA polymerase that catalyzes translesion DNA synthesis, which allows DNA replication in the presence of DNA lesions. Human cell lines lacking a functional copy of this gene exhibit impaired genome integrity and enhanced susceptibility to oxidative damage. Mutations in this gene that impair enzyme activity may be associated with prostate cancer in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation of this gene that results in a truncated transcript results in a higher rate of spontaneous germline expanded simple tandem repeat mutations. Homozyogus null mice exhibit normal immunoglobulin gene somatic hypermutation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	G	A	16: 20,365,951	P986L	probably damaging	Het
Acad10	A	T	5: 121,631,393	Y667N	possibly damaging	Het
Ahi1	G	A	10: 20,963,115	G121D	probably benign	Het
Ampd1	T	A	3: 103,099,126	I690N	possibly damaging	Het
Amy1	C	A	3: 113,558,165	W425L	possibly damaging	Het
Arhgap27	A	T	11: 103,333,005	V823E	probably damaging	Het
Arhgef17	A	G	7: 100,929,870	S624P	probably damaging	Het
Arid5b	T	C	10: 68,186,067	H231R	probably damaging	Het
Aspscr1	C	A	11: 120,688,560	T78N	probably damaging	Het
Auts2	T	A	5: 131,472,450	T42S	probably damaging	Het
Ccdc171	A	G	4: 83,554,808	D158G	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap61	T	C	2: 145,939,993		probably null	Het
Chrna5	T	C	9: 55,004,651	V245A	possibly damaging	Het
Cntnap5c	G	A	17: 58,013,921	G163R	probably damaging	Het
Col5a2	A	G	1: 45,378,305		probably null	Het
Col5a2	T	C	1: 45,394,776	Q759R	probably damaging	Het
Comp	A	G	8: 70,377,146	D340G	probably benign	Het
Cyfip1	T	A	7: 55,926,395	D1104E	probably damaging	Het
Dnah11	A	T	12: 118,038,780	S308T	probably damaging	Het
Dnah5	A	G	15: 28,270,426	H958R	probably benign	Het
Elp3	A	G	14: 65,547,919	Y478H	probably damaging	Het
Fat3	T	C	9: 16,376,985	Y414C	probably benign	Het
Fbxo10	C	A	4: 45,046,389	A574S	probably damaging	Het
Fsip2	G	T	2: 82,977,562	L1408F	probably benign	Het
Fubp3	T	C	2: 31,611,735	V425A	possibly damaging	Het
Gm7168	A	T	17: 13,949,584	R404S	probably benign	Het
Gm8773	A	T	5: 5,575,652	Q116L	possibly damaging	Het
Gpd1	T	G	15: 99,723,202	F299C	probably damaging	Het
Gpr137	C	T	19: 6,942,057		probably benign	Het
Grin3b	T	C	10: 79,973,408	S331P	probably benign	Het
Grk3	T	A	5: 112,941,718	I281F	probably damaging	Het
Hoxb7	T	A	11: 96,286,781	S18R	probably damaging	Het
Igf1r	C	T	7: 68,214,933	R1160*	probably null	Het
Itfg1	A	G	8: 85,725,512		probably null	Het
Itgb8	T	C	12: 119,202,455	I114V	probably benign	Het
Kcnk1	A	G	8: 126,025,384	E243G	possibly damaging	Het
Kif27	A	G	13: 58,344,008	L439P	probably damaging	Het
Kif2c	T	A	4: 117,167,361	Q279L	probably benign	Het
Kmt2d	A	T	15: 98,852,074		probably benign	Het
L3mbtl1	A	G	2: 162,974,502	T821A	probably benign	Het
Lrrc24	A	T	15: 76,722,578	M206K	probably benign	Het
Mamdc4	T	G	2: 25,567,622	K460Q	possibly damaging	Het
Maml2	C	G	9: 13,697,345	L30V	probably damaging	Het
Mc5r	C	G	18: 68,338,670		probably null	Het
Myo10	T	G	15: 25,726,525		probably null	Het
Myo1e	T	A	9: 70,338,784	L419Q	probably damaging	Het
Myo6	C	A	9: 80,300,572	H1115Q	probably damaging	Het
Myo7a	A	G	7: 98,107,095	V10A	probably damaging	Het
Myoz2	C	T	3: 123,026,127	R61H	probably damaging	Het
Ncdn	G	A	4: 126,752,003	R38C	probably damaging	Het
Nckap1	T	A	2: 80,520,556	T736S	probably benign	Het
Ncor2	G	A	5: 125,019,890	A2325V	probably damaging	Het
Nid2	T	A	14: 19,752,431	V140E	possibly damaging	Het
Nlrp9c	C	A	7: 26,380,490	D704Y	probably benign	Het
Notch3	T	A	17: 32,158,725	S126C	probably damaging	Het
Olfr1128	A	T	2: 87,544,983	L187H	probably damaging	Het
Olfr130	T	C	17: 38,067,948	I259T	probably damaging	Het
Olfr215	A	C	6: 116,582,697	F83C	probably damaging	Het
Olfr484	A	G	7: 108,124,915	F116S	probably benign	Het
Olfr804	T	C	10: 129,705,607	M243T	possibly damaging	Het
Olfr818	A	T	10: 129,945,582	L160*	probably null	Het
Pdzd7	A	G	19: 45,039,228	I269T	probably damaging	Het
Phf3	A	T	1: 30,806,206	D1299E	probably damaging	Het
Pitx2	T	A	3: 129,218,754	Y271N	probably damaging	Het
Prkdc	C	A	16: 15,739,524	N2230K	probably damaging	Het
Prlr	A	G	15: 10,322,536	E170G	probably benign	Het
Prss55	A	G	14: 64,075,730	I235T	probably damaging	Het
Psd3	T	C	8: 67,960,565	I724V	probably benign	Het
Rabep2	A	G	7: 126,438,799	T248A	possibly damaging	Het
Rbm26	T	A	14: 105,117,073	K949N	probably benign	Het
Rnf213	T	A	11: 119,440,221	D2085E	probably damaging	Het
Serpinb7	A	T	1: 107,450,273	H232L	possibly damaging	Het
Slu7	A	G	11: 43,445,242	Q484R	probably benign	Het
Smg1	A	G	7: 118,145,798	S3044P	possibly damaging	Het
Snrnp48	A	G	13: 38,221,360	D248G	possibly damaging	Het
Snrpc	C	A	17: 27,845,219	P66Q	unknown	Het
Snrpn	T	A	7: 59,983,459		probably benign	Het
Spag17	T	A	3: 99,939,356	S65R	possibly damaging	Het
Srsf6	C	A	2: 162,934,488		probably benign	Het
Stil	T	A	4: 115,041,782	M1203K	probably benign	Het
Syt17	T	C	7: 118,436,838	T106A	probably benign	Het
Tbx15	C	T	3: 99,352,246	Q478*	probably null	Het
Tg	A	T	15: 66,737,548	Q319L	probably benign	Het
Thada	A	G	17: 84,448,033	L243P	probably damaging	Het
Thada	G	T	17: 84,448,034	L243I	probably damaging	Het
Tnnt3	A	G	7: 142,512,364	R211G	probably damaging	Het
Togaram1	A	T	12: 65,002,635	Q1282L	possibly damaging	Het
Tpm3-rs7	T	G	14: 113,314,947	M91R	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Ttll7	T	G	3: 146,915,780	L378R	probably damaging	Het
Tyw1	T	G	5: 130,258,993	I22R	probably damaging	Het
Ubr3	T	C	2: 70,016,367	S1645P	possibly damaging	Het
Ubr4	T	C	4: 139,393,053	L263P	probably damaging	Het
Unc13c	T	C	9: 73,756,339	E1071G	possibly damaging	Het
Vmn2r44	G	T	7: 8,380,123	D157E	possibly damaging	Het
Vps16	C	T	2: 130,443,600	T821I	probably benign	Het
Washc4	T	C	10: 83,579,525	V793A	possibly damaging	Het
Wdr35	G	T	12: 8,977,435		probably null	Het
Zfp277	A	G	12: 40,364,085	F254L	probably benign	Het

Other mutations in Polk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00491:Polk	APN	13	96496760	missense	probably benign	0.25
IGL01803:Polk	APN	13	96504522	missense	probably damaging	1.00
IGL01949:Polk	APN	13	96483538	missense	probably benign	0.10
IGL01986:Polk	APN	13	96483823	missense	probably benign	0.09
IGL02073:Polk	APN	13	96504551	missense	probably damaging	1.00
IGL03165:Polk	APN	13	96516688	missense	probably benign	0.23
IGL03184:Polk	APN	13	96483983	missense	probably benign	0.04
IGL03353:Polk	APN	13	96489211	missense	probably damaging	1.00
R0019:Polk	UTSW	13	96504616	missense	probably damaging	1.00
R0029:Polk	UTSW	13	96516670	missense	probably damaging	1.00
R0200:Polk	UTSW	13	96496822	missense	probably benign	0.11
R0357:Polk	UTSW	13	96504597	missense	probably damaging	0.99
R0485:Polk	UTSW	13	96483764	missense	probably benign	0.05
R0555:Polk	UTSW	13	96484179	missense	probably damaging	0.97
R0687:Polk	UTSW	13	96484017	missense	probably damaging	1.00
R0980:Polk	UTSW	13	96483764	missense	probably benign	0.05
R1065:Polk	UTSW	13	96508252	missense	probably damaging	1.00
R1396:Polk	UTSW	13	96484208	missense	probably benign	0.02
R1710:Polk	UTSW	13	96489204	missense	probably damaging	1.00
R1770:Polk	UTSW	13	96495442	missense	probably damaging	1.00
R1977:Polk	UTSW	13	96489228	missense	probably damaging	1.00
R2301:Polk	UTSW	13	96484144	missense	probably benign	0.09
R3797:Polk	UTSW	13	96486982	splice site	probably benign
R3934:Polk	UTSW	13	96501635	missense	possibly damaging	0.56
R4082:Polk	UTSW	13	96483673	missense	probably benign	0.17
R4307:Polk	UTSW	13	96496666	missense	possibly damaging	0.79
R4472:Polk	UTSW	13	96493905	missense	probably damaging	1.00
R4779:Polk	UTSW	13	96496491	critical splice donor site	probably null
R4795:Polk	UTSW	13	96489256	missense	probably benign	0.01
R4796:Polk	UTSW	13	96489256	missense	probably benign	0.01
R4810:Polk	UTSW	13	96483495	missense	possibly damaging	0.90
R5002:Polk	UTSW	13	96489244	missense	probably damaging	1.00
R5271:Polk	UTSW	13	96483539	missense	probably benign	0.09
R5415:Polk	UTSW	13	96483955	missense	probably benign
R5459:Polk	UTSW	13	96495476	missense	probably damaging	1.00
R5535:Polk	UTSW	13	96495497	missense	probably damaging	1.00
R5619:Polk	UTSW	13	96483556	missense	probably damaging	1.00
R5757:Polk	UTSW	13	96484252	missense	probably benign	0.03
R5801:Polk	UTSW	13	96483586	missense	probably damaging	1.00
R5923:Polk	UTSW	13	96495415	missense	probably damaging	1.00
R6365:Polk	UTSW	13	96484009	missense	probably damaging	1.00
R6670:Polk	UTSW	13	96496630	nonsense	probably null
R6831:Polk	UTSW	13	96495491	missense	possibly damaging	0.87
R6932:Polk	UTSW	13	96516681	missense	probably damaging	1.00
R7216:Polk	UTSW	13	96508220	missense	probably benign	0.32
R7654:Polk	UTSW	13	96496813	missense	probably benign	0.02
R8122:Polk	UTSW	13	96483783	missense	probably benign	0.01
R8222:Polk	UTSW	13	96495515	missense	possibly damaging	0.95
R9024:Polk	UTSW	13	96486832	missense	probably benign	0.00
R9500:Polk	UTSW	13	96493841	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTAGACCTGTGATAGCTTTTGTGC -3'
(R):5'- TGTTTGTGATCCAGACACACC -3'

Sequencing Primer
(F):5'- GCTTGATTACAGCTTACCTGGAG -3'
(R):5'- ACTGAGTATGAGCGGTCCATCTC -3'

Posted On

2014-06-23