Incidental Mutation 'R1789:Prlr'
ID201663
Institutional Source Beutler Lab
Gene Symbol Prlr
Ensembl Gene ENSMUSG00000005268
Gene Nameprolactin receptor
SynonymsPrlr-rs1, Pr-1
MMRRC Submission 039820-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.435) question?
Stock #R1789 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location10177238-10349180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10322536 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 170 (E170G)
Ref Sequence ENSEMBL: ENSMUSP00000121280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124470] [ENSMUST00000127467] [ENSMUST00000128450] [ENSMUST00000128921] [ENSMUST00000130720] [ENSMUST00000134410] [ENSMUST00000137867] [ENSMUST00000148257]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000005400
Predicted Effect probably benign
Transcript: ENSMUST00000124470
AA Change: E170G

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122219
Gene: ENSMUSG00000005268
AA Change: E170G

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
transmembrane domain 231 253 N/A INTRINSIC
low complexity region 278 291 N/A INTRINSIC
low complexity region 342 356 N/A INTRINSIC
low complexity region 384 397 N/A INTRINSIC
low complexity region 454 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127467
SMART Domains Protein: ENSMUSP00000116211
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 59 143 3.78e0 SMART
Blast:FN3 158 185 7e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128450
AA Change: E170G

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122209
Gene: ENSMUSG00000005268
AA Change: E170G

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128921
AA Change: E170G

PolyPhen 2 Score 0.324 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121280
Gene: ENSMUSG00000005268
AA Change: E170G

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130720
SMART Domains Protein: ENSMUSP00000117084
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132361
Predicted Effect probably benign
Transcript: ENSMUST00000134410
SMART Domains Protein: ENSMUSP00000120417
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137867
AA Change: E170G

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121935
Gene: ENSMUSG00000005268
AA Change: E170G

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145428
Predicted Effect probably benign
Transcript: ENSMUST00000148257
AA Change: E170G

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118355
Gene: ENSMUSG00000005268
AA Change: E170G

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000157020
SMART Domains Protein: ENSMUSP00000120297
Gene: ENSMUSG00000094814

DomainStartEndE-ValueType
transmembrane domain 20 41 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for the anterior pituitary hormone, prolactin, and belongs to the type I cytokine receptor family. Prolactin-dependent signaling occurs as the result of ligand-induced dimerization of the prolactin receptor. Several alternatively spliced transcript variants encoding different membrane-bound and soluble isoforms have been described for this gene, which may function to modulate the endocrine and autocrine effects of prolactin in normal tissue and cancer. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal growth, hormone and glucose homeostasis, hair cycling, female reproductive behavior, morphology, and function, and thyroid, prostate, Hardarian, and lacrimal gland morphologies. Heterozygous mice exhibit defective neuron proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G A 16: 20,365,951 P986L probably damaging Het
Acad10 A T 5: 121,631,393 Y667N possibly damaging Het
Ahi1 G A 10: 20,963,115 G121D probably benign Het
Ampd1 T A 3: 103,099,126 I690N possibly damaging Het
Amy1 C A 3: 113,558,165 W425L possibly damaging Het
Arhgap27 A T 11: 103,333,005 V823E probably damaging Het
Arhgef17 A G 7: 100,929,870 S624P probably damaging Het
Arid5b T C 10: 68,186,067 H231R probably damaging Het
Aspscr1 C A 11: 120,688,560 T78N probably damaging Het
Auts2 T A 5: 131,472,450 T42S probably damaging Het
Ccdc171 A G 4: 83,554,808 D158G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap61 T C 2: 145,939,993 probably null Het
Chrna5 T C 9: 55,004,651 V245A possibly damaging Het
Cntnap5c G A 17: 58,013,921 G163R probably damaging Het
Col5a2 A G 1: 45,378,305 probably null Het
Col5a2 T C 1: 45,394,776 Q759R probably damaging Het
Comp A G 8: 70,377,146 D340G probably benign Het
Cyfip1 T A 7: 55,926,395 D1104E probably damaging Het
Dnah11 A T 12: 118,038,780 S308T probably damaging Het
Dnah5 A G 15: 28,270,426 H958R probably benign Het
Elp3 A G 14: 65,547,919 Y478H probably damaging Het
Fat3 T C 9: 16,376,985 Y414C probably benign Het
Fbxo10 C A 4: 45,046,389 A574S probably damaging Het
Fsip2 G T 2: 82,977,562 L1408F probably benign Het
Fubp3 T C 2: 31,611,735 V425A possibly damaging Het
Gm7168 A T 17: 13,949,584 R404S probably benign Het
Gm8773 A T 5: 5,575,652 Q116L possibly damaging Het
Gpd1 T G 15: 99,723,202 F299C probably damaging Het
Gpr137 C T 19: 6,942,057 probably benign Het
Grin3b T C 10: 79,973,408 S331P probably benign Het
Grk3 T A 5: 112,941,718 I281F probably damaging Het
Hoxb7 T A 11: 96,286,781 S18R probably damaging Het
Igf1r C T 7: 68,214,933 R1160* probably null Het
Itfg1 A G 8: 85,725,512 probably null Het
Itgb8 T C 12: 119,202,455 I114V probably benign Het
Kcnk1 A G 8: 126,025,384 E243G possibly damaging Het
Kif27 A G 13: 58,344,008 L439P probably damaging Het
Kif2c T A 4: 117,167,361 Q279L probably benign Het
Kmt2d A T 15: 98,852,074 probably benign Het
L3mbtl1 A G 2: 162,974,502 T821A probably benign Het
Lrrc24 A T 15: 76,722,578 M206K probably benign Het
Mamdc4 T G 2: 25,567,622 K460Q possibly damaging Het
Maml2 C G 9: 13,697,345 L30V probably damaging Het
Mc5r C G 18: 68,338,670 probably null Het
Myo10 T G 15: 25,726,525 probably null Het
Myo1e T A 9: 70,338,784 L419Q probably damaging Het
Myo6 C A 9: 80,300,572 H1115Q probably damaging Het
Myo7a A G 7: 98,107,095 V10A probably damaging Het
Myoz2 C T 3: 123,026,127 R61H probably damaging Het
Ncdn G A 4: 126,752,003 R38C probably damaging Het
Nckap1 T A 2: 80,520,556 T736S probably benign Het
Ncor2 G A 5: 125,019,890 A2325V probably damaging Het
Nid2 T A 14: 19,752,431 V140E possibly damaging Het
Nlrp9c C A 7: 26,380,490 D704Y probably benign Het
Notch3 T A 17: 32,158,725 S126C probably damaging Het
Olfr1128 A T 2: 87,544,983 L187H probably damaging Het
Olfr130 T C 17: 38,067,948 I259T probably damaging Het
Olfr215 A C 6: 116,582,697 F83C probably damaging Het
Olfr484 A G 7: 108,124,915 F116S probably benign Het
Olfr804 T C 10: 129,705,607 M243T possibly damaging Het
Olfr818 A T 10: 129,945,582 L160* probably null Het
Pdzd7 A G 19: 45,039,228 I269T probably damaging Het
Phf3 A T 1: 30,806,206 D1299E probably damaging Het
Pitx2 T A 3: 129,218,754 Y271N probably damaging Het
Polk T C 13: 96,496,632 E301G probably damaging Het
Prkdc C A 16: 15,739,524 N2230K probably damaging Het
Prss55 A G 14: 64,075,730 I235T probably damaging Het
Psd3 T C 8: 67,960,565 I724V probably benign Het
Rabep2 A G 7: 126,438,799 T248A possibly damaging Het
Rbm26 T A 14: 105,117,073 K949N probably benign Het
Rnf213 T A 11: 119,440,221 D2085E probably damaging Het
Serpinb7 A T 1: 107,450,273 H232L possibly damaging Het
Slu7 A G 11: 43,445,242 Q484R probably benign Het
Smg1 A G 7: 118,145,798 S3044P possibly damaging Het
Snrnp48 A G 13: 38,221,360 D248G possibly damaging Het
Snrpc C A 17: 27,845,219 P66Q unknown Het
Snrpn T A 7: 59,983,459 probably benign Het
Spag17 T A 3: 99,939,356 S65R possibly damaging Het
Srsf6 C A 2: 162,934,488 probably benign Het
Stil T A 4: 115,041,782 M1203K probably benign Het
Syt17 T C 7: 118,436,838 T106A probably benign Het
Tbx15 C T 3: 99,352,246 Q478* probably null Het
Tg A T 15: 66,737,548 Q319L probably benign Het
Thada A G 17: 84,448,033 L243P probably damaging Het
Thada G T 17: 84,448,034 L243I probably damaging Het
Tnnt3 A G 7: 142,512,364 R211G probably damaging Het
Togaram1 A T 12: 65,002,635 Q1282L possibly damaging Het
Tpm3-rs7 T G 14: 113,314,947 M91R probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Ttll7 T G 3: 146,915,780 L378R probably damaging Het
Tyw1 T G 5: 130,258,993 I22R probably damaging Het
Ubr3 T C 2: 70,016,367 S1645P possibly damaging Het
Ubr4 T C 4: 139,393,053 L263P probably damaging Het
Unc13c T C 9: 73,756,339 E1071G possibly damaging Het
Vmn2r44 G T 7: 8,380,123 D157E possibly damaging Het
Vps16 C T 2: 130,443,600 T821I probably benign Het
Washc4 T C 10: 83,579,525 V793A possibly damaging Het
Wdr35 G T 12: 8,977,435 probably null Het
Zfp277 A G 12: 40,364,085 F254L probably benign Het
Other mutations in Prlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Prlr APN 15 10328324 missense probably benign 0.00
IGL00688:Prlr APN 15 10322381 unclassified probably benign
IGL01527:Prlr APN 15 10329171 missense probably benign 0.28
IGL01626:Prlr APN 15 10328718 missense probably benign 0.12
IGL01660:Prlr APN 15 10317590 missense probably damaging 1.00
IGL01835:Prlr APN 15 10329043 missense probably damaging 1.00
IGL01926:Prlr APN 15 10314220 start codon destroyed probably null 0.76
IGL01952:Prlr APN 15 10328342 missense possibly damaging 0.95
IGL02306:Prlr APN 15 10328674 missense probably benign 0.05
IGL02394:Prlr APN 15 10328578 missense probably benign 0.03
IGL02430:Prlr APN 15 10325391 missense probably damaging 1.00
IGL02695:Prlr APN 15 10328365 missense probably benign 0.20
IGL02745:Prlr APN 15 10328594 missense possibly damaging 0.50
IGL03193:Prlr APN 15 10328290 missense possibly damaging 0.57
IGL03277:Prlr APN 15 10328801 missense probably benign 0.01
IGL03379:Prlr APN 15 10319317 missense possibly damaging 0.80
PIT4434001:Prlr UTSW 15 10328372 missense probably damaging 1.00
R0057:Prlr UTSW 15 10328423 missense probably damaging 0.99
R0057:Prlr UTSW 15 10328423 missense probably damaging 0.99
R0545:Prlr UTSW 15 10317566 missense probably damaging 1.00
R1236:Prlr UTSW 15 10325281 missense probably benign 0.13
R1352:Prlr UTSW 15 10328786 missense probably benign
R1524:Prlr UTSW 15 10319333 missense probably damaging 0.97
R1537:Prlr UTSW 15 10328278 splice site probably null
R1690:Prlr UTSW 15 10317590 missense probably damaging 1.00
R1773:Prlr UTSW 15 10325318 nonsense probably null
R2421:Prlr UTSW 15 10319257 missense probably damaging 1.00
R4518:Prlr UTSW 15 10328999 missense possibly damaging 0.53
R4621:Prlr UTSW 15 10319376 intron probably benign
R4855:Prlr UTSW 15 10328797 missense probably benign 0.01
R4957:Prlr UTSW 15 10319195 missense probably damaging 1.00
R5053:Prlr UTSW 15 10325385 missense probably benign 0.00
R5731:Prlr UTSW 15 10314135 missense probably benign 0.00
R5749:Prlr UTSW 15 10328718 missense probably benign 0.12
R5806:Prlr UTSW 15 10319204 missense probably damaging 1.00
R5927:Prlr UTSW 15 10322446 missense probably benign 0.42
R6170:Prlr UTSW 15 10328849 missense probably benign 0.05
R6911:Prlr UTSW 15 10329184 missense probably benign
R6935:Prlr UTSW 15 10319302 missense probably damaging 1.00
R7327:Prlr UTSW 15 10346438 missense probably benign 0.00
R7539:Prlr UTSW 15 10329023 missense probably benign 0.11
R7579:Prlr UTSW 15 10328935 missense probably benign 0.08
R7615:Prlr UTSW 15 10325924 missense probably damaging 1.00
R7651:Prlr UTSW 15 10328378 missense probably benign 0.26
Z1176:Prlr UTSW 15 10314255 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTATCATGCCCTCTAGGAGCTC -3'
(R):5'- GGGGAGGAATTTCCATACCC -3'

Sequencing Primer
(F):5'- CCTCTAGGAGCTCATTATACAGTGG -3'
(R):5'- GGAATTTCCATACCCAGGAGG -3'
Posted On2014-06-23