Mutagenetix > Incidental Mutations

Incidental Mutation 'R1789:Trappc9'

201668

Institutional Source

Beutler Lab

Gene Symbol

Trappc9

Ensembl Gene

ENSMUSG00000047921

Gene Name

trafficking protein particle complex 9

Synonyms

TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik

MMRRC Submission

039820-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1789 (G1)

Quality Score

188

Status

Not validated

Chromosome

Chromosomal Location

72589620-73061204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 73025967 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 377 (R377W)

Ref Sequence

ENSEMBL: ENSMUSP00000131997 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633] [ENSMUST00000228960]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023276
AA Change: R189W

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: R189W

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	2	920	3.6e-239	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000089770
AA Change: R368W

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: R368W

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	182	350	4.1e-20	PFAM
Pfam:TRAPPC9-Trs120	434	664	2.2e-16	PFAM
low complexity region	993	1004	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000168191
AA Change: R368W

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: R368W

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	810	3.7e-222	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000170633
AA Change: R377W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: R377W

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	820	7.6e-224	PFAM
coiled coil region	857	885	N/A	INTRINSIC
low complexity region	906	929	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000228960
AA Change: R368W

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230025

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230270

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	G	A	16: 20,365,951	P986L	probably damaging	Het
Acad10	A	T	5: 121,631,393	Y667N	possibly damaging	Het
Ahi1	G	A	10: 20,963,115	G121D	probably benign	Het
Ampd1	T	A	3: 103,099,126	I690N	possibly damaging	Het
Amy1	C	A	3: 113,558,165	W425L	possibly damaging	Het
Arhgap27	A	T	11: 103,333,005	V823E	probably damaging	Het
Arhgef17	A	G	7: 100,929,870	S624P	probably damaging	Het
Arid5b	T	C	10: 68,186,067	H231R	probably damaging	Het
Aspscr1	C	A	11: 120,688,560	T78N	probably damaging	Het
Auts2	T	A	5: 131,472,450	T42S	probably damaging	Het
Ccdc171	A	G	4: 83,554,808	D158G	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap61	T	C	2: 145,939,993		probably null	Het
Chrna5	T	C	9: 55,004,651	V245A	possibly damaging	Het
Cntnap5c	G	A	17: 58,013,921	G163R	probably damaging	Het
Col5a2	A	G	1: 45,378,305		probably null	Het
Col5a2	T	C	1: 45,394,776	Q759R	probably damaging	Het
Comp	A	G	8: 70,377,146	D340G	probably benign	Het
Cyfip1	T	A	7: 55,926,395	D1104E	probably damaging	Het
Dnah11	A	T	12: 118,038,780	S308T	probably damaging	Het
Dnah5	A	G	15: 28,270,426	H958R	probably benign	Het
Elp3	A	G	14: 65,547,919	Y478H	probably damaging	Het
Fat3	T	C	9: 16,376,985	Y414C	probably benign	Het
Fbxo10	C	A	4: 45,046,389	A574S	probably damaging	Het
Fsip2	G	T	2: 82,977,562	L1408F	probably benign	Het
Fubp3	T	C	2: 31,611,735	V425A	possibly damaging	Het
Gm7168	A	T	17: 13,949,584	R404S	probably benign	Het
Gm8773	A	T	5: 5,575,652	Q116L	possibly damaging	Het
Gpd1	T	G	15: 99,723,202	F299C	probably damaging	Het
Gpr137	C	T	19: 6,942,057		probably benign	Het
Grin3b	T	C	10: 79,973,408	S331P	probably benign	Het
Grk3	T	A	5: 112,941,718	I281F	probably damaging	Het
Hoxb7	T	A	11: 96,286,781	S18R	probably damaging	Het
Igf1r	C	T	7: 68,214,933	R1160*	probably null	Het
Itfg1	A	G	8: 85,725,512		probably null	Het
Itgb8	T	C	12: 119,202,455	I114V	probably benign	Het
Kcnk1	A	G	8: 126,025,384	E243G	possibly damaging	Het
Kif27	A	G	13: 58,344,008	L439P	probably damaging	Het
Kif2c	T	A	4: 117,167,361	Q279L	probably benign	Het
Kmt2d	A	T	15: 98,852,074		probably benign	Het
L3mbtl1	A	G	2: 162,974,502	T821A	probably benign	Het
Lrrc24	A	T	15: 76,722,578	M206K	probably benign	Het
Mamdc4	T	G	2: 25,567,622	K460Q	possibly damaging	Het
Maml2	C	G	9: 13,697,345	L30V	probably damaging	Het
Mc5r	C	G	18: 68,338,670		probably null	Het
Myo10	T	G	15: 25,726,525		probably null	Het
Myo1e	T	A	9: 70,338,784	L419Q	probably damaging	Het
Myo6	C	A	9: 80,300,572	H1115Q	probably damaging	Het
Myo7a	A	G	7: 98,107,095	V10A	probably damaging	Het
Myoz2	C	T	3: 123,026,127	R61H	probably damaging	Het
Ncdn	G	A	4: 126,752,003	R38C	probably damaging	Het
Nckap1	T	A	2: 80,520,556	T736S	probably benign	Het
Ncor2	G	A	5: 125,019,890	A2325V	probably damaging	Het
Nid2	T	A	14: 19,752,431	V140E	possibly damaging	Het
Nlrp9c	C	A	7: 26,380,490	D704Y	probably benign	Het
Notch3	T	A	17: 32,158,725	S126C	probably damaging	Het
Olfr1128	A	T	2: 87,544,983	L187H	probably damaging	Het
Olfr130	T	C	17: 38,067,948	I259T	probably damaging	Het
Olfr215	A	C	6: 116,582,697	F83C	probably damaging	Het
Olfr484	A	G	7: 108,124,915	F116S	probably benign	Het
Olfr804	T	C	10: 129,705,607	M243T	possibly damaging	Het
Olfr818	A	T	10: 129,945,582	L160*	probably null	Het
Pdzd7	A	G	19: 45,039,228	I269T	probably damaging	Het
Phf3	A	T	1: 30,806,206	D1299E	probably damaging	Het
Pitx2	T	A	3: 129,218,754	Y271N	probably damaging	Het
Polk	T	C	13: 96,496,632	E301G	probably damaging	Het
Prkdc	C	A	16: 15,739,524	N2230K	probably damaging	Het
Prlr	A	G	15: 10,322,536	E170G	probably benign	Het
Prss55	A	G	14: 64,075,730	I235T	probably damaging	Het
Psd3	T	C	8: 67,960,565	I724V	probably benign	Het
Rabep2	A	G	7: 126,438,799	T248A	possibly damaging	Het
Rbm26	T	A	14: 105,117,073	K949N	probably benign	Het
Rnf213	T	A	11: 119,440,221	D2085E	probably damaging	Het
Serpinb7	A	T	1: 107,450,273	H232L	possibly damaging	Het
Slu7	A	G	11: 43,445,242	Q484R	probably benign	Het
Smg1	A	G	7: 118,145,798	S3044P	possibly damaging	Het
Snrnp48	A	G	13: 38,221,360	D248G	possibly damaging	Het
Snrpc	C	A	17: 27,845,219	P66Q	unknown	Het
Snrpn	T	A	7: 59,983,459		probably benign	Het
Spag17	T	A	3: 99,939,356	S65R	possibly damaging	Het
Srsf6	C	A	2: 162,934,488		probably benign	Het
Stil	T	A	4: 115,041,782	M1203K	probably benign	Het
Syt17	T	C	7: 118,436,838	T106A	probably benign	Het
Tbx15	C	T	3: 99,352,246	Q478*	probably null	Het
Tg	A	T	15: 66,737,548	Q319L	probably benign	Het
Thada	A	G	17: 84,448,033	L243P	probably damaging	Het
Thada	G	T	17: 84,448,034	L243I	probably damaging	Het
Tnnt3	A	G	7: 142,512,364	R211G	probably damaging	Het
Togaram1	A	T	12: 65,002,635	Q1282L	possibly damaging	Het
Tpm3-rs7	T	G	14: 113,314,947	M91R	probably damaging	Het
Ttll7	T	G	3: 146,915,780	L378R	probably damaging	Het
Tyw1	T	G	5: 130,258,993	I22R	probably damaging	Het
Ubr3	T	C	2: 70,016,367	S1645P	possibly damaging	Het
Ubr4	T	C	4: 139,393,053	L263P	probably damaging	Het
Unc13c	T	C	9: 73,756,339	E1071G	possibly damaging	Het
Vmn2r44	G	T	7: 8,380,123	D157E	possibly damaging	Het
Vps16	C	T	2: 130,443,600	T821I	probably benign	Het
Washc4	T	C	10: 83,579,525	V793A	possibly damaging	Het
Wdr35	G	T	12: 8,977,435		probably null	Het
Zfp277	A	G	12: 40,364,085	F254L	probably benign	Het

Other mutations in Trappc9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Trappc9	APN	15	73026026	missense	possibly damaging	0.79
IGL01348:Trappc9	APN	15	72937009	missense	possibly damaging	0.64
IGL01367:Trappc9	APN	15	72590153	missense	probably benign	0.31
IGL01521:Trappc9	APN	15	73052167	missense	probably damaging	1.00
IGL01726:Trappc9	APN	15	72946122	missense	probably damaging	0.98
IGL01881:Trappc9	APN	15	72999992	missense	probably damaging	1.00
IGL02214:Trappc9	APN	15	73012882	nonsense	probably null
IGL02693:Trappc9	APN	15	72963693	splice site	probably benign
IGL03229:Trappc9	APN	15	73058456	missense	probably damaging	1.00
basilio	UTSW	15	73058393	missense	probably damaging	1.00
Boomboom	UTSW	15	72736869	nonsense	probably null
Sotto_aceto	UTSW	15	72685339	missense	probably damaging	0.99
P0026:Trappc9	UTSW	15	72953082	missense	probably damaging	1.00
PIT4453001:Trappc9	UTSW	15	73031598	frame shift	probably null
PIT4519001:Trappc9	UTSW	15	72953094	missense	probably benign
R0001:Trappc9	UTSW	15	72963662	missense	probably damaging	1.00
R0094:Trappc9	UTSW	15	72894929	intron	probably benign
R0745:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0747:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0800:Trappc9	UTSW	15	72953132	splice site	probably benign
R0816:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0819:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0820:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0893:Trappc9	UTSW	15	72590107	missense	probably damaging	1.00
R0976:Trappc9	UTSW	15	72999974	missense	probably damaging	0.99
R1119:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1266:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1453:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1454:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1531:Trappc9	UTSW	15	72693548	nonsense	probably null
R1543:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1563:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1565:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1600:Trappc9	UTSW	15	72937109	nonsense	probably null
R1712:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1756:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1978:Trappc9	UTSW	15	73000025	missense	probably damaging	1.00
R2001:Trappc9	UTSW	15	73058036	missense	probably damaging	0.99
R2312:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2334:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2926:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3123:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3124:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3125:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3813:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R4012:Trappc9	UTSW	15	73031623	missense	possibly damaging	0.95
R4080:Trappc9	UTSW	15	72941947	missense	probably damaging	1.00
R4282:Trappc9	UTSW	15	72590792	missense	probably damaging	1.00
R4572:Trappc9	UTSW	15	72937067	missense	possibly damaging	0.61
R4739:Trappc9	UTSW	15	72937060	missense	probably damaging	0.97
R4959:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R4973:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R5123:Trappc9	UTSW	15	72913366	intron	probably benign
R5128:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R5228:Trappc9	UTSW	15	73057995	missense	probably damaging	1.00
R5362:Trappc9	UTSW	15	73058217	missense	possibly damaging	0.68
R5802:Trappc9	UTSW	15	72685339	missense	probably damaging	0.99
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6154:Trappc9	UTSW	15	73058081	missense	probably benign	0.03
R6372:Trappc9	UTSW	15	72590074	missense	possibly damaging	0.75
R6661:Trappc9	UTSW	15	72590144	missense	possibly damaging	0.55
R6864:Trappc9	UTSW	15	72937162	splice site	probably null
R6893:Trappc9	UTSW	15	72925650	missense	possibly damaging	0.93
R7099:Trappc9	UTSW	15	72693619	missense	probably benign	0.00
R7276:Trappc9	UTSW	15	73052270	missense	probably damaging	0.99
R7349:Trappc9	UTSW	15	72736869	nonsense	probably null
R8260:Trappc9	UTSW	15	72941909	nonsense	probably null
R8399:Trappc9	UTSW	15	73052282	missense	probably damaging	1.00
R8683:Trappc9	UTSW	15	73012815	missense	probably benign	0.26
RF008:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF009:Trappc9	UTSW	15	72801287	small insertion	probably benign
RF014:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF016:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801324	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801331	small insertion	probably benign
RF028:Trappc9	UTSW	15	72801290	small insertion	probably benign
RF029:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF030:Trappc9	UTSW	15	72801325	small insertion	probably benign
RF034:Trappc9	UTSW	15	72801298	small insertion	probably benign
RF036:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF038:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF040:Trappc9	UTSW	15	72801292	small insertion	probably benign
RF042:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF043:Trappc9	UTSW	15	72801305	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801301	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801306	small insertion	probably benign
RF053:Trappc9	UTSW	15	72801328	small insertion	probably benign
RF057:Trappc9	UTSW	15	72801295	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801324	small insertion	probably benign
Z1177:Trappc9	UTSW	15	73052162	missense	probably null	0.51

Predicted Primers

PCR Primer
(F):5'- AACTGGGAGGAGATGGTGAATTTTC -3'
(R):5'- TGTGCCCGTTAAGACAGACC -3'

Sequencing Primer
(F):5'- GAAAGTCCTGTGTTCAAATCCCAG -3'
(R):5'- GAAATAGCTTTCCCCGAGGGTATC -3'

Posted On

2014-06-23