Mutagenetix > Incidental Mutation

Incidental Mutation 'R1789:Trappc9'

201668

Institutional Source

Beutler Lab

Gene Symbol

Trappc9

Ensembl Gene

ENSMUSG00000047921

Gene Name

trafficking protein particle complex 9

Synonyms

TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik

MMRRC Submission

039820-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1789 (G1)

Quality Score

188

Status

Not validated

Chromosome

Chromosomal Location

72589620-73061204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 73025967 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 377 (R377W)

Ref Sequence

ENSEMBL: ENSMUSP00000131997 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633] [ENSMUST00000228960]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000023276
AA Change: R189W

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: R189W

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	2	920	3.6e-239	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000089770
AA Change: R368W

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: R368W

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	182	350	4.1e-20	PFAM
Pfam:TRAPPC9-Trs120	434	664	2.2e-16	PFAM
low complexity region	993	1004	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000168191
AA Change: R368W

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: R368W

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	810	3.7e-222	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000170633
AA Change: R377W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: R377W

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	820	7.6e-224	PFAM
coiled coil region	857	885	N/A	INTRINSIC
low complexity region	906	929	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000228960
AA Change: R368W

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230025

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230270

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	G	A	16: 20,365,951	P986L	probably damaging	Het
Acad10	A	T	5: 121,631,393	Y667N	possibly damaging	Het
Ahi1	G	A	10: 20,963,115	G121D	probably benign	Het
Ampd1	T	A	3: 103,099,126	I690N	possibly damaging	Het
Amy1	C	A	3: 113,558,165	W425L	possibly damaging	Het
Arhgap27	A	T	11: 103,333,005	V823E	probably damaging	Het
Arhgef17	A	G	7: 100,929,870	S624P	probably damaging	Het
Arid5b	T	C	10: 68,186,067	H231R	probably damaging	Het
Aspscr1	C	A	11: 120,688,560	T78N	probably damaging	Het
Auts2	T	A	5: 131,472,450	T42S	probably damaging	Het
Ccdc171	A	G	4: 83,554,808	D158G	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap61	T	C	2: 145,939,993		probably null	Het
Chrna5	T	C	9: 55,004,651	V245A	possibly damaging	Het
Cntnap5c	G	A	17: 58,013,921	G163R	probably damaging	Het
Col5a2	A	G	1: 45,378,305		probably null	Het
Col5a2	T	C	1: 45,394,776	Q759R	probably damaging	Het
Comp	A	G	8: 70,377,146	D340G	probably benign	Het
Cyfip1	T	A	7: 55,926,395	D1104E	probably damaging	Het
Dnah11	A	T	12: 118,038,780	S308T	probably damaging	Het
Dnah5	A	G	15: 28,270,426	H958R	probably benign	Het
Elp3	A	G	14: 65,547,919	Y478H	probably damaging	Het
Fat3	T	C	9: 16,376,985	Y414C	probably benign	Het
Fbxo10	C	A	4: 45,046,389	A574S	probably damaging	Het
Fsip2	G	T	2: 82,977,562	L1408F	probably benign	Het
Fubp3	T	C	2: 31,611,735	V425A	possibly damaging	Het
Gm7168	A	T	17: 13,949,584	R404S	probably benign	Het
Gm8773	A	T	5: 5,575,652	Q116L	possibly damaging	Het
Gpd1	T	G	15: 99,723,202	F299C	probably damaging	Het
Gpr137	C	T	19: 6,942,057		probably benign	Het
Grin3b	T	C	10: 79,973,408	S331P	probably benign	Het
Grk3	T	A	5: 112,941,718	I281F	probably damaging	Het
Hoxb7	T	A	11: 96,286,781	S18R	probably damaging	Het
Igf1r	C	T	7: 68,214,933	R1160*	probably null	Het
Itfg1	A	G	8: 85,725,512		probably null	Het
Itgb8	T	C	12: 119,202,455	I114V	probably benign	Het
Kcnk1	A	G	8: 126,025,384	E243G	possibly damaging	Het
Kif27	A	G	13: 58,344,008	L439P	probably damaging	Het
Kif2c	T	A	4: 117,167,361	Q279L	probably benign	Het
Kmt2d	A	T	15: 98,852,074		probably benign	Het
L3mbtl1	A	G	2: 162,974,502	T821A	probably benign	Het
Lrrc24	A	T	15: 76,722,578	M206K	probably benign	Het
Mamdc4	T	G	2: 25,567,622	K460Q	possibly damaging	Het
Maml2	C	G	9: 13,697,345	L30V	probably damaging	Het
Mc5r	C	G	18: 68,338,670		probably null	Het
Myo10	T	G	15: 25,726,525		probably null	Het
Myo1e	T	A	9: 70,338,784	L419Q	probably damaging	Het
Myo6	C	A	9: 80,300,572	H1115Q	probably damaging	Het
Myo7a	A	G	7: 98,107,095	V10A	probably damaging	Het
Myoz2	C	T	3: 123,026,127	R61H	probably damaging	Het
Ncdn	G	A	4: 126,752,003	R38C	probably damaging	Het
Nckap1	T	A	2: 80,520,556	T736S	probably benign	Het
Ncor2	G	A	5: 125,019,890	A2325V	probably damaging	Het
Nid2	T	A	14: 19,752,431	V140E	possibly damaging	Het
Nlrp9c	C	A	7: 26,380,490	D704Y	probably benign	Het
Notch3	T	A	17: 32,158,725	S126C	probably damaging	Het
Olfr1128	A	T	2: 87,544,983	L187H	probably damaging	Het
Olfr130	T	C	17: 38,067,948	I259T	probably damaging	Het
Olfr215	A	C	6: 116,582,697	F83C	probably damaging	Het
Olfr484	A	G	7: 108,124,915	F116S	probably benign	Het
Olfr804	T	C	10: 129,705,607	M243T	possibly damaging	Het
Olfr818	A	T	10: 129,945,582	L160*	probably null	Het
Pdzd7	A	G	19: 45,039,228	I269T	probably damaging	Het
Phf3	A	T	1: 30,806,206	D1299E	probably damaging	Het
Pitx2	T	A	3: 129,218,754	Y271N	probably damaging	Het
Polk	T	C	13: 96,496,632	E301G	probably damaging	Het
Prkdc	C	A	16: 15,739,524	N2230K	probably damaging	Het
Prlr	A	G	15: 10,322,536	E170G	probably benign	Het
Prss55	A	G	14: 64,075,730	I235T	probably damaging	Het
Psd3	T	C	8: 67,960,565	I724V	probably benign	Het
Rabep2	A	G	7: 126,438,799	T248A	possibly damaging	Het
Rbm26	T	A	14: 105,117,073	K949N	probably benign	Het
Rnf213	T	A	11: 119,440,221	D2085E	probably damaging	Het
Serpinb7	A	T	1: 107,450,273	H232L	possibly damaging	Het
Slu7	A	G	11: 43,445,242	Q484R	probably benign	Het
Smg1	A	G	7: 118,145,798	S3044P	possibly damaging	Het
Snrnp48	A	G	13: 38,221,360	D248G	possibly damaging	Het
Snrpc	C	A	17: 27,845,219	P66Q	unknown	Het
Snrpn	T	A	7: 59,983,459		probably benign	Het
Spag17	T	A	3: 99,939,356	S65R	possibly damaging	Het
Srsf6	C	A	2: 162,934,488		probably benign	Het
Stil	T	A	4: 115,041,782	M1203K	probably benign	Het
Syt17	T	C	7: 118,436,838	T106A	probably benign	Het
Tbx15	C	T	3: 99,352,246	Q478*	probably null	Het
Tg	A	T	15: 66,737,548	Q319L	probably benign	Het
Thada	A	G	17: 84,448,033	L243P	probably damaging	Het
Thada	G	T	17: 84,448,034	L243I	probably damaging	Het
Tnnt3	A	G	7: 142,512,364	R211G	probably damaging	Het
Togaram1	A	T	12: 65,002,635	Q1282L	possibly damaging	Het
Tpm3-rs7	T	G	14: 113,314,947	M91R	probably damaging	Het
Ttll7	T	G	3: 146,915,780	L378R	probably damaging	Het
Tyw1	T	G	5: 130,258,993	I22R	probably damaging	Het
Ubr3	T	C	2: 70,016,367	S1645P	possibly damaging	Het
Ubr4	T	C	4: 139,393,053	L263P	probably damaging	Het
Unc13c	T	C	9: 73,756,339	E1071G	possibly damaging	Het
Vmn2r44	G	T	7: 8,380,123	D157E	possibly damaging	Het
Vps16	C	T	2: 130,443,600	T821I	probably benign	Het
Washc4	T	C	10: 83,579,525	V793A	possibly damaging	Het
Wdr35	G	T	12: 8,977,435		probably null	Het
Zfp277	A	G	12: 40,364,085	F254L	probably benign	Het

Other mutations in Trappc9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Trappc9	APN	15	73026026	missense	possibly damaging	0.79
IGL01348:Trappc9	APN	15	72937009	missense	possibly damaging	0.64
IGL01367:Trappc9	APN	15	72590153	missense	probably benign	0.31
IGL01521:Trappc9	APN	15	73052167	missense	probably damaging	1.00
IGL01726:Trappc9	APN	15	72946122	missense	probably damaging	0.98
IGL01881:Trappc9	APN	15	72999992	missense	probably damaging	1.00
IGL02214:Trappc9	APN	15	73012882	nonsense	probably null
IGL02693:Trappc9	APN	15	72963693	splice site	probably benign
IGL03229:Trappc9	APN	15	73058456	missense	probably damaging	1.00
basilio	UTSW	15	73058393	missense	probably damaging	1.00
Boomboom	UTSW	15	72736869	nonsense	probably null
bronto	UTSW	15	73058238	nonsense	probably null
Earl	UTSW	15	72736777	nonsense	probably null
Sotto_aceto	UTSW	15	72685339	missense	probably damaging	0.99
P0026:Trappc9	UTSW	15	72953082	missense	probably damaging	1.00
PIT4453001:Trappc9	UTSW	15	73031598	frame shift	probably null
PIT4519001:Trappc9	UTSW	15	72953094	missense	probably benign
R0001:Trappc9	UTSW	15	72963662	missense	probably damaging	1.00
R0094:Trappc9	UTSW	15	72894929	intron	probably benign
R0745:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0747:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0800:Trappc9	UTSW	15	72953132	splice site	probably benign
R0816:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0819:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0820:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0893:Trappc9	UTSW	15	72590107	missense	probably damaging	1.00
R0976:Trappc9	UTSW	15	72999974	missense	probably damaging	0.99
R1119:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1266:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1453:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1454:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1531:Trappc9	UTSW	15	72693548	nonsense	probably null
R1543:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1563:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1565:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1600:Trappc9	UTSW	15	72937109	nonsense	probably null
R1712:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1756:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1978:Trappc9	UTSW	15	73000025	missense	probably damaging	1.00
R2001:Trappc9	UTSW	15	73058036	missense	probably damaging	0.99
R2312:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2334:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2926:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3123:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3124:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3125:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3813:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R4012:Trappc9	UTSW	15	73031623	missense	possibly damaging	0.95
R4080:Trappc9	UTSW	15	72941947	missense	probably damaging	1.00
R4282:Trappc9	UTSW	15	72590792	missense	probably damaging	1.00
R4572:Trappc9	UTSW	15	72937067	missense	possibly damaging	0.61
R4739:Trappc9	UTSW	15	72937060	missense	probably damaging	0.97
R4959:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R4973:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R5123:Trappc9	UTSW	15	72913366	intron	probably benign
R5128:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R5228:Trappc9	UTSW	15	73057995	missense	probably damaging	1.00
R5362:Trappc9	UTSW	15	73058217	missense	possibly damaging	0.68
R5802:Trappc9	UTSW	15	72685339	missense	probably damaging	0.99
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6154:Trappc9	UTSW	15	73058081	missense	probably benign	0.03
R6372:Trappc9	UTSW	15	72590074	missense	possibly damaging	0.75
R6661:Trappc9	UTSW	15	72590144	missense	possibly damaging	0.55
R6864:Trappc9	UTSW	15	72937162	splice site	probably null
R6893:Trappc9	UTSW	15	72925650	missense	possibly damaging	0.93
R7099:Trappc9	UTSW	15	72693619	missense	probably benign	0.00
R7276:Trappc9	UTSW	15	73052270	missense	probably damaging	0.99
R7349:Trappc9	UTSW	15	72736869	nonsense	probably null
R8260:Trappc9	UTSW	15	72941909	nonsense	probably null
R8399:Trappc9	UTSW	15	73052282	missense	probably damaging	1.00
R8683:Trappc9	UTSW	15	73012815	missense	probably benign	0.26
R8839:Trappc9	UTSW	15	73058238	nonsense	probably null
R8945:Trappc9	UTSW	15	73058096	missense	probably benign
R9083:Trappc9	UTSW	15	72736777	nonsense	probably null
R9323:Trappc9	UTSW	15	72693582	missense	probably benign	0.41
R9329:Trappc9	UTSW	15	72801353	missense	unknown
R9366:Trappc9	UTSW	15	72937088	missense	probably benign
R9723:Trappc9	UTSW	15	72590114	missense	possibly damaging	0.87
RF008:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF009:Trappc9	UTSW	15	72801287	small insertion	probably benign
RF014:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF016:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801324	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801331	small insertion	probably benign
RF028:Trappc9	UTSW	15	72801290	small insertion	probably benign
RF029:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF030:Trappc9	UTSW	15	72801325	small insertion	probably benign
RF034:Trappc9	UTSW	15	72801298	small insertion	probably benign
RF036:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF038:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF040:Trappc9	UTSW	15	72801292	small insertion	probably benign
RF042:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF043:Trappc9	UTSW	15	72801305	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801301	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801306	small insertion	probably benign
RF053:Trappc9	UTSW	15	72801328	small insertion	probably benign
RF057:Trappc9	UTSW	15	72801295	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801324	small insertion	probably benign
Z1177:Trappc9	UTSW	15	73052162	missense	probably null	0.51

Predicted Primers

PCR Primer
(F):5'- AACTGGGAGGAGATGGTGAATTTTC -3'
(R):5'- TGTGCCCGTTAAGACAGACC -3'

Sequencing Primer
(F):5'- GAAAGTCCTGTGTTCAAATCCCAG -3'
(R):5'- GAAATAGCTTTCCCCGAGGGTATC -3'

Posted On

2014-06-23