Incidental Mutation 'R0090:Aggf1'
ID20169
Institutional Source Beutler Lab
Gene Symbol Aggf1
Ensembl Gene ENSMUSG00000021681
Gene Nameangiogenic factor with G patch and FHA domains 1
Synonyms2010009L17Rik, 2310029P06Rik, VG5Q
MMRRC Submission 038377-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.448) question?
Stock #R0090 (G1)
Quality Score225
Status Validated (trace)
Chromosome13
Chromosomal Location95350683-95375352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95364959 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 305 (I305T)
Ref Sequence ENSEMBL: ENSMUSP00000022189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022189]
Predicted Effect probably benign
Transcript: ENSMUST00000022189
AA Change: I305T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000022189
Gene: ENSMUSG00000021681
AA Change: I305T

DomainStartEndE-ValueType
coiled coil region 20 85 N/A INTRINSIC
low complexity region 128 137 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
internal_repeat_1 205 225 4.68e-9 PROSPERO
internal_repeat_1 221 241 4.68e-9 PROSPERO
low complexity region 270 280 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 380 401 N/A INTRINSIC
FHA 430 484 1.51e-9 SMART
low complexity region 548 561 N/A INTRINSIC
G_patch 614 660 1.31e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161671
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.7%
  • 20x: 91.4%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an angiogenic factor that promotes proliferation of endothelial cells. Mutations in this gene are associated with a susceptibility to Klippel-Trenaunay syndrome. Pseudogenes of this gene are found on chromosomes 3, 4, 10 and 16.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous null embryos die before E8.5. Heterozygotes exhibit defective angiogenesis in yolk sacs and embryos and partial lethality. Surviving adults show hemorrhages, increased vascular permeability, and reduced tumor growth of implanted melanoma cell lines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
4933427I04Rik A G 4: 123,860,982 T230A possibly damaging Het
9230110C19Rik T A 9: 8,027,183 N118I probably benign Het
Acsm1 T C 7: 119,662,189 probably benign Het
Acta1 T C 8: 123,893,657 N14S probably damaging Het
Aff4 A G 11: 53,392,782 T362A probably benign Het
Ap4b1 A G 3: 103,820,429 D325G possibly damaging Het
Ap4e1 C T 2: 127,064,985 T1055I possibly damaging Het
Arhgef2 A T 3: 88,639,348 Q496L probably damaging Het
Arhgef28 A G 13: 98,075,110 F122L probably damaging Het
Baiap3 G A 17: 25,250,070 probably benign Het
Casp8ap2 T A 4: 32,640,327 H460Q probably damaging Het
Casz1 A G 4: 148,933,411 T386A probably benign Het
Cd53 A T 3: 106,767,409 V114E possibly damaging Het
Celsr2 A G 3: 108,393,327 probably benign Het
Chaf1b G T 16: 93,887,124 A88S possibly damaging Het
Cldn10 A T 14: 118,874,200 Y194F probably damaging Het
Clec2e A C 6: 129,095,218 probably null Het
Cmpk2 A T 12: 26,478,022 T413S probably benign Het
Col9a1 T A 1: 24,223,562 probably null Het
Dchs1 G T 7: 105,755,932 Q2468K probably benign Het
Ddx60 A G 8: 61,942,293 D88G probably damaging Het
Dnah8 A G 17: 30,784,090 R3588G probably benign Het
Ect2 T C 3: 27,115,476 T774A probably benign Het
Ect2 C T 3: 27,138,502 E431K probably null Het
Ern1 A G 11: 106,405,823 V767A probably damaging Het
Fbln1 A C 15: 85,224,288 E75A possibly damaging Het
Fgf5 C T 5: 98,261,987 R132* probably null Het
Folh1 T C 7: 86,725,868 probably benign Het
Gdf15 A T 8: 70,629,684 H257Q probably damaging Het
Ghitm T C 14: 37,122,219 T322A probably benign Het
Gm13212 A T 4: 145,622,625 K211* probably null Het
Gm5709 A G 3: 59,618,771 noncoding transcript Het
Hbb-y C T 7: 103,852,743 probably null Het
Hmcn2 A T 2: 31,426,198 D3771V probably damaging Het
Hspa12a T C 19: 58,799,509 D627G probably benign Het
Idh2 T C 7: 80,097,914 E286G probably damaging Het
Idh3b C A 2: 130,280,979 A297S probably benign Het
Igsf3 A G 3: 101,435,652 E535G probably damaging Het
Ilf3 T A 9: 21,395,414 D314E probably damaging Het
Itgb8 A G 12: 119,202,563 S78P probably benign Het
Itih5 G A 2: 10,164,684 V31I probably benign Het
Kcnj2 T C 11: 111,073,027 V415A probably benign Het
Kin A G 2: 10,085,773 Q53R possibly damaging Het
Krt78 A T 15: 101,947,837 M513K probably benign Het
Krtap4-8 A T 11: 99,780,486 probably benign Het
Ltbr T C 6: 125,309,449 probably benign Het
Mgat4a G A 1: 37,490,333 T146I probably damaging Het
Mrps2 G C 2: 28,468,256 W19C probably damaging Het
Mthfs T C 9: 89,211,291 S33P probably damaging Het
Myh6 T C 14: 54,958,704 D546G probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Ndst2 T C 14: 20,727,267 T553A probably damaging Het
Nlrp12 T C 7: 3,240,034 E616G probably damaging Het
Nrde2 T C 12: 100,129,286 probably benign Het
Nup210l G A 3: 90,211,779 V1832I probably benign Het
Olfr1283 A T 2: 111,369,294 I221F probably damaging Het
Olfr376 G A 11: 73,375,576 V276I probably benign Het
Pcm1 A T 8: 41,256,041 E9D probably damaging Het
Pear1 A T 3: 87,754,342 D541E possibly damaging Het
Peg10 A G 6: 4,756,063 probably benign Het
Prss1 G A 6: 41,461,232 R31Q probably benign Het
Ptpn13 T C 5: 103,569,503 V1837A probably damaging Het
Rasgrp3 A G 17: 75,498,461 D149G probably damaging Het
Reg3d A T 6: 78,378,483 H8Q possibly damaging Het
Rhox4f A C X: 37,607,469 V15G probably benign Het
Sacs T A 14: 61,205,440 L1645H probably damaging Het
Slc16a5 A T 11: 115,464,925 S71C probably damaging Het
Slc9a3 A G 13: 74,158,728 E324G probably damaging Het
Smgc T C 15: 91,859,762 V574A possibly damaging Het
Stac3 C T 10: 127,503,930 probably benign Het
Supv3l1 A G 10: 62,429,706 L685P probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tas2r125 G T 6: 132,910,398 A250S probably benign Het
Tdrd6 C T 17: 43,628,241 V639I probably benign Het
Thap12 T G 7: 98,715,893 W423G probably damaging Het
Tmem245 T C 4: 56,899,410 I217V probably benign Het
Trip12 T A 1: 84,732,136 probably benign Het
Tshz3 T C 7: 36,768,892 V102A probably benign Het
Ubap1 T C 4: 41,379,826 S347P probably damaging Het
Usp10 C T 8: 119,953,196 Q612* probably null Het
Vmn2r72 T C 7: 85,754,876 I36V probably benign Het
Vps37a T C 8: 40,526,989 I63T possibly damaging Het
Whrn C A 4: 63,432,732 R9L possibly damaging Het
Xrcc1 T C 7: 24,570,217 Y401H probably damaging Het
Ylpm1 GCCTAAGCAGCAACCTAAG GCCTAAG 12: 85,029,040 probably benign Het
Zfhx3 G A 8: 108,950,057 D2580N possibly damaging Het
Zfhx4 A G 3: 5,243,625 N637S probably damaging Het
Zyg11a A T 4: 108,201,347 probably benign Het
Other mutations in Aggf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Aggf1 APN 13 95362477 missense probably damaging 1.00
IGL01083:Aggf1 APN 13 95356409 missense probably damaging 1.00
IGL01296:Aggf1 APN 13 95353971 missense probably damaging 1.00
IGL01811:Aggf1 APN 13 95351572 missense probably benign 0.04
IGL02089:Aggf1 APN 13 95370929 missense probably benign 0.22
IGL02351:Aggf1 APN 13 95352850 splice site probably benign
IGL02358:Aggf1 APN 13 95352850 splice site probably benign
IGL02534:Aggf1 APN 13 95369522 missense possibly damaging 0.76
PIT4687001:Aggf1 UTSW 13 95364875 missense probably damaging 0.99
R0189:Aggf1 UTSW 13 95356480 splice site probably benign
R0332:Aggf1 UTSW 13 95369446 missense probably damaging 1.00
R0334:Aggf1 UTSW 13 95371597 missense probably benign 0.02
R0445:Aggf1 UTSW 13 95354001 missense possibly damaging 0.74
R0523:Aggf1 UTSW 13 95356416 missense probably damaging 0.99
R0575:Aggf1 UTSW 13 95368397 missense probably benign 0.02
R0647:Aggf1 UTSW 13 95371656 splice site probably null
R1401:Aggf1 UTSW 13 95364848 missense probably benign 0.02
R1495:Aggf1 UTSW 13 95356413 nonsense probably null
R1542:Aggf1 UTSW 13 95370942 missense probably benign 0.00
R1688:Aggf1 UTSW 13 95364767 missense probably damaging 1.00
R2225:Aggf1 UTSW 13 95370846 missense probably damaging 0.96
R2226:Aggf1 UTSW 13 95370846 missense probably damaging 0.96
R4405:Aggf1 UTSW 13 95371594 missense probably benign 0.00
R4764:Aggf1 UTSW 13 95364713 missense probably damaging 0.96
R5819:Aggf1 UTSW 13 95351621 missense possibly damaging 0.76
R5878:Aggf1 UTSW 13 95369557 missense probably benign 0.18
R5946:Aggf1 UTSW 13 95371576 missense probably damaging 1.00
R6056:Aggf1 UTSW 13 95371615 missense probably benign 0.00
R6823:Aggf1 UTSW 13 95364723 missense probably benign 0.11
R7051:Aggf1 UTSW 13 95351617 missense possibly damaging 0.94
R7638:Aggf1 UTSW 13 95356413 nonsense probably null
R7682:Aggf1 UTSW 13 95368426 missense probably benign 0.41
R7903:Aggf1 UTSW 13 95356458 missense probably damaging 1.00
RF014:Aggf1 UTSW 13 95370768 missense possibly damaging 0.87
X0010:Aggf1 UTSW 13 95364977 missense probably benign
X0064:Aggf1 UTSW 13 95362870 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACTCGACCTCTACAAGCTGAC -3'
(R):5'- GGAGTGCCTCCCACTTGGATATTG -3'

Sequencing Primer
(F):5'- TGCCCGAGTGAATCACTTAC -3'
(R):5'- CCCACTTGGATATTGGGATCAATC -3'
Posted On2013-04-11