Mutagenetix > Incidental Mutation

Incidental Mutation 'R1791:Pkhd1'

201690

Institutional Source

Beutler Lab

Gene Symbol

Pkhd1

Ensembl Gene

ENSMUSG00000043760

Gene Name

polycystic kidney and hepatic disease 1

Synonyms

FPC, tigmin

MMRRC Submission

039821-MU

Accession Numbers

Genbank: NM_153179; MGI: 2155808

Essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R1791 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20057779-20618064 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 20585152 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000085794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088448]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000088448

SMART Domains

Protein: ENSMUSP00000085794
Gene: ENSMUSG00000043760

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Blast:IPT	134	254	1e-45	BLAST
IPT	256	353	1.13e-3	SMART
low complexity region	722	743	N/A	INTRINSIC
low complexity region	896	909	N/A	INTRINSIC
Pfam:TIG	936	1005	9.1e-8	PFAM
IPT	1016	1101	1.18e-6	SMART
IPT	1105	1190	1.27e0	SMART
IPT	1193	1290	7.05e-5	SMART
IPT	1384	1467	1.36e1	SMART
IPT	1568	1655	2.4e0	SMART
low complexity region	1881	1892	N/A	INTRINSIC
G8	1928	2049	1.15e-48	SMART
low complexity region	2079	2094	N/A	INTRINSIC
PbH1	2244	2266	7.82e3	SMART
PbH1	2287	2321	2.23e3	SMART
PbH1	2404	2426	7.19e2	SMART
PbH1	2459	2481	2.64e2	SMART
low complexity region	2713	2728	N/A	INTRINSIC
G8	2734	2867	1.73e-43	SMART
Blast:G8	2876	2923	2e-17	BLAST
PbH1	3004	3026	3.98e3	SMART
PbH1	3027	3049	1.27e0	SMART
PbH1	3080	3102	5.92e2	SMART
low complexity region	3178	3187	N/A	INTRINSIC
PbH1	3188	3212	8.08e3	SMART
transmembrane domain	3852	3874	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.6%

Validation Efficiency

95% (104/110)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to have a single transmembrane (TM)-spanning domain and multiple copies of an immunoglobulin-like plexin-transcription-factor domain. Alternative splicing results in two transcript variants encoding different isoforms. Other alternatively spliced transcripts have been described, but the full length sequences have not been determined. Several of these transcripts are predicted to encode truncated products which lack the TM and may be secreted. Mutations in this gene cause autosomal recessive polycystic kidney disease, also known as polycystic kidney and hepatic disease-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene display variable progressive liver cysts and fibrosis, but do not display kidney cysts and are fertile. Mice homozygous for a hypomorphic and null allele display renal, pancreatic, billiary and liver cysts. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	C	A	6: 121,654,612	L623M	probably benign	Het
Akap13	T	G	7: 75,611,035	C333G	probably benign	Het
Akap6	T	C	12: 53,069,125	S1004P	probably damaging	Het
Akap7	T	C	10: 25,239,685	T181A	probably benign	Het
Ap3b1	A	G	13: 94,408,797	E186G	possibly damaging	Het
Arhgap17	T	C	7: 123,286,702	T736A	probably benign	Het
Bmp8a	G	T	4: 123,324,585	R214S	possibly damaging	Het
Cacna1f	T	C	X: 7,620,439	S890P	probably damaging	Het
Cd96	A	T	16: 46,117,999	Y34*	probably null	Het
Cdc42ep4	A	G	11: 113,729,337	L76P	probably damaging	Het
Cdh23	A	G	10: 60,391,726	V1195A	possibly damaging	Het
Cfap57	G	A	4: 118,571,724	T1015M	possibly damaging	Het
Chrm3	C	A	13: 9,877,416	G528V	probably damaging	Het
Clip4	T	C	17: 71,801,942		probably benign	Het
Col9a1	A	T	1: 24,185,305	R189S	unknown	Het
Cul4b	A	T	X: 38,547,851	I481N	probably damaging	Het
Cyp26b1	A	G	6: 84,584,459	S74P	probably benign	Het
Cyp3a57	A	G	5: 145,371,010	N192S	probably benign	Het
Dcbld1	A	G	10: 52,319,476	D260G	probably damaging	Het
Dhrs7	T	C	12: 72,653,165	N231S	probably benign	Het
Disp3	G	A	4: 148,241,518	P1261L	probably damaging	Het
Dyx1c1	T	C	9: 72,960,684	Y76H	possibly damaging	Het
Eml5	C	A	12: 98,887,056	V95F	probably benign	Het
Emsy	A	G	7: 98,647,880	I32T	probably damaging	Het
Esr1	A	G	10: 4,783,913	R238G	probably damaging	Het
Exosc1	T	C	19: 41,928,085	K84R	probably benign	Het
F830016B08Rik	T	A	18: 60,300,517	V224E	probably benign	Het
Fam228a	T	A	12: 4,732,748	N115I	probably damaging	Het
Farp1	T	C	14: 121,256,745	I546T	probably damaging	Het
Fbxo30	T	A	10: 11,289,787	C84*	probably null	Het
Fbxw17	A	G	13: 50,425,774		probably benign	Het
Foxo4	G	C	X: 101,258,463	R192P	probably benign	Het
Galnt7	G	T	8: 57,542,530	T377K	probably benign	Het
Garnl3	T	C	2: 33,034,127	I248V	probably benign	Het
Glod4	A	G	11: 76,237,708	Y104H	probably damaging	Het
Glrb	T	C	3: 80,860,175	Y246C	probably damaging	Het
Gm5292	A	G	5: 43,944,410		noncoding transcript	Het
Gm5424	C	A	10: 62,072,307		noncoding transcript	Het
Gm7276	C	T	18: 77,185,735		probably benign	Het
Gm9774	T	A	3: 92,428,231	D388V	probably damaging	Het
Golga5	A	G	12: 102,492,131	N611S	possibly damaging	Het
Gucy2c	A	C	6: 136,744,027	Y391D	probably damaging	Het
H6pd	A	G	4: 149,981,673	I760T	probably damaging	Het
Hapln2	T	A	3: 88,024,405	I5F	possibly damaging	Het
Hdac11	G	T	6: 91,168,824	V169L	probably benign	Het
Hectd2	T	C	19: 36,609,416	V557A	possibly damaging	Het
Huwe1	T	A	X: 151,864,753	N747K	probably benign	Het
Ints1	A	G	5: 139,774,522	S66P	probably benign	Het
Ipo7	A	G	7: 110,027,132	D49G	probably damaging	Het
Itgb4	G	A	11: 115,988,520	C575Y	probably damaging	Het
Klhl3	A	G	13: 58,033,230	V250A	possibly damaging	Het
Klk1b24	A	G	7: 44,190,428		probably null	Het
Map3k11	T	A	19: 5,695,572	Y333*	probably null	Het
Mbp	A	G	18: 82,554,349	T57A	probably benign	Het
Myh9	A	G	15: 77,773,264		probably benign	Het
Mypn	C	T	10: 63,125,693	R1040Q	probably damaging	Het
Ncdn	A	G	4: 126,751,939		probably null	Het
Ndn	C	T	7: 62,348,508	P34L	probably benign	Het
Odf3l1	A	T	9: 56,851,743	F43I	possibly damaging	Het
Olfr509	T	A	7: 108,646,364	T71S	probably benign	Het
Olfr566	G	A	7: 102,856,362	Q307*	probably null	Het
Olfr623	T	C	7: 103,660,798		probably null	Het
Olfr726	A	G	14: 50,084,042	F213S	probably benign	Het
Olfr749	AGGGATTGGG	AGGGATTGGGATTGGG	14: 50,736,687		probably benign	Het
Olfr924	T	A	9: 38,848,605	S164T	possibly damaging	Het
Pbx3	T	C	2: 34,224,452	T82A	possibly damaging	Het
Pi15	T	C	1: 17,602,721	F48S	probably benign	Het
Ppard	C	G	17: 28,286,374	R12G	unknown	Het
Prrc2c	G	T	1: 162,704,982		probably benign	Het
Prune1	A	G	3: 95,268,242	Y41H	possibly damaging	Het
Rcsd1	T	C	1: 165,655,972	D150G	probably damaging	Het
Rgs12	A	T	5: 34,966,112	Q413L	possibly damaging	Het
Rhox2h	A	G	X: 37,669,195	Y185H	probably damaging	Het
Rnf17	T	A	14: 56,504,007	C1306*	probably null	Het
Ros1	T	A	10: 52,100,087	M1499L	probably benign	Het
Rubcnl	T	C	14: 75,047,549	S503P	probably damaging	Het
Sap18b	A	T	8: 95,825,714	R117S	probably benign	Het
Shank2	A	G	7: 144,410,599	E858G	probably damaging	Het
Shtn1	T	C	19: 59,032,200	R197G	probably damaging	Het
Slamf8	G	A	1: 172,584,520	R163*	probably null	Het
Slc6a3	T	C	13: 73,566,292	I392T	possibly damaging	Het
Sp140	C	T	1: 85,620,051		probably benign	Het
Sp8	T	C	12: 118,849,016	V202A	possibly damaging	Het
Spata13	T	C	14: 60,709,459	V652A	probably damaging	Het
Stpg2	A	T	3: 139,317,401	T393S	probably benign	Het
Tagap	T	C	17: 7,931,467	M228T	probably damaging	Het
Tagap	A	G	17: 7,933,545	T521A	probably benign	Het
Tas2r123	T	G	6: 132,847,565	S142A	probably damaging	Het
Tat	T	A	8: 109,991,629	S49T	probably benign	Het
Tfap4	G	T	16: 4,552,069	Q41K	possibly damaging	Het
Thbs2	T	C	17: 14,685,813	N275S	probably benign	Het
Tnfsf14	T	A	17: 57,190,867	R122W	probably damaging	Het
Tnrc6a	T	C	7: 123,192,917	V1886A	possibly damaging	Het
Trim56	G	A	5: 137,114,398	A88V	probably damaging	Het
Trio	A	G	15: 27,841,756	Y1081H	probably damaging	Het
Tspear	T	A	10: 77,870,419	L341H	possibly damaging	Het
Ube2o	G	A	11: 116,541,494	T882I	probably benign	Het
Uhrf1bp1	T	A	17: 27,894,746	D1297E	probably damaging	Het
Upk3a	A	G	15: 85,020,614	T188A	possibly damaging	Het
Vmn1r79	A	C	7: 12,176,431	D80A	probably damaging	Het
Wls	C	A	3: 159,911,813	T375K	probably benign	Het
Wnt5a	T	C	14: 28,511,878	M1T	probably null	Het
Zcchc4	A	G	5: 52,796,590	E204G	probably damaging	Het
Zfp513	G	A	5: 31,200,334	P232S	possibly damaging	Het

Other mutations in Pkhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Pkhd1	APN	1	20566874	critical splice acceptor site	probably null
IGL00687:Pkhd1	APN	1	20524070	missense	probably benign	0.19
IGL00824:Pkhd1	APN	1	20081184	critical splice donor site	probably null
IGL00870:Pkhd1	APN	1	20571390	missense	probably damaging	1.00
IGL00911:Pkhd1	APN	1	20117747	missense	probably benign	0.00
IGL01015:Pkhd1	APN	1	20523258	missense	possibly damaging	0.95
IGL01025:Pkhd1	APN	1	20209176	missense	probably benign	0.04
IGL01064:Pkhd1	APN	1	20534530	splice site	probably benign
IGL01313:Pkhd1	APN	1	20201024	missense	probably damaging	1.00
IGL01340:Pkhd1	APN	1	20522977	missense	probably benign	0.01
IGL01352:Pkhd1	APN	1	20549715	missense	probably benign	0.34
IGL01456:Pkhd1	APN	1	20199459	missense	probably damaging	1.00
IGL01530:Pkhd1	APN	1	20559419	critical splice donor site	probably null
IGL01557:Pkhd1	APN	1	20116979	missense	possibly damaging	0.59
IGL01655:Pkhd1	APN	1	20534633	nonsense	probably null
IGL01790:Pkhd1	APN	1	20558671	missense	probably damaging	0.96
IGL01862:Pkhd1	APN	1	20358910	missense	probably damaging	1.00
IGL01874:Pkhd1	APN	1	20103235	missense	probably benign	0.32
IGL01901:Pkhd1	APN	1	20220083	missense	probably benign	0.11
IGL01903:Pkhd1	APN	1	20198137	missense	probably damaging	1.00
IGL01981:Pkhd1	APN	1	20523567	missense	possibly damaging	0.64
IGL02068:Pkhd1	APN	1	20522747	missense	probably damaging	1.00
IGL02083:Pkhd1	APN	1	20201227	missense	probably damaging	1.00
IGL02084:Pkhd1	APN	1	20377399	missense	probably damaging	1.00
IGL02126:Pkhd1	APN	1	20117195	missense	probably damaging	1.00
IGL02136:Pkhd1	APN	1	20275615	missense	probably damaging	1.00
IGL02255:Pkhd1	APN	1	20584101	missense	probably damaging	1.00
IGL02272:Pkhd1	APN	1	20209260	missense	probably damaging	1.00
IGL02308:Pkhd1	APN	1	20070376	critical splice donor site	probably null
IGL02364:Pkhd1	APN	1	20200783	missense	probably benign
IGL02389:Pkhd1	APN	1	20117720	missense	probably damaging	0.99
IGL02394:Pkhd1	APN	1	20199486	missense	possibly damaging	0.57
IGL02403:Pkhd1	APN	1	20562418	missense	probably benign	0.01
IGL02415:Pkhd1	APN	1	20414421	missense	probably damaging	1.00
IGL02415:Pkhd1	APN	1	20522759	missense	probably damaging	1.00
IGL02455:Pkhd1	APN	1	20364201	missense	probably damaging	1.00
IGL02502:Pkhd1	APN	1	20392165	missense	probably damaging	1.00
IGL02511:Pkhd1	APN	1	20073507	missense	possibly damaging	0.90
IGL02530:Pkhd1	APN	1	20117720	missense	probably damaging	0.99
IGL02532:Pkhd1	APN	1	20117720	missense	probably damaging	0.99
IGL02534:Pkhd1	APN	1	20117720	missense	probably damaging	0.99
IGL02556:Pkhd1	APN	1	20310710	missense	probably damaging	1.00
IGL02570:Pkhd1	APN	1	20520256	missense	probably damaging	0.99
IGL02605:Pkhd1	APN	1	20550902	missense	possibly damaging	0.66
IGL02641:Pkhd1	APN	1	20558752	missense	possibly damaging	0.61
IGL02741:Pkhd1	APN	1	20220029	splice site	probably benign
IGL02752:Pkhd1	APN	1	20553591	missense	possibly damaging	0.57
IGL02890:Pkhd1	APN	1	20361011	missense	probably damaging	1.00
IGL02959:Pkhd1	APN	1	20608416	nonsense	probably null
IGL02960:Pkhd1	APN	1	20377446	missense	possibly damaging	0.69
IGL02990:Pkhd1	APN	1	20522963	missense	possibly damaging	0.52
IGL03037:Pkhd1	APN	1	20522699	missense	probably benign	0.06
IGL03082:Pkhd1	APN	1	20565633	missense	probably damaging	1.00
IGL03114:Pkhd1	APN	1	20198171	missense	probably damaging	0.99
IGL03288:Pkhd1	APN	1	20201019	missense	probably benign	0.01
IGL03328:Pkhd1	APN	1	20081300	splice site	probably benign
IGL03375:Pkhd1	APN	1	20117023	missense	probably damaging	1.00
IGL03380:Pkhd1	APN	1	20200670	missense	probably damaging	1.00
0152:Pkhd1	UTSW	1	20522894	missense	possibly damaging	0.46
IGL03046:Pkhd1	UTSW	1	20537365	missense	possibly damaging	0.81
LCD18:Pkhd1	UTSW	1	20611414	intron	probably benign
P0035:Pkhd1	UTSW	1	20117347	missense	probably benign	0.00
PIT4260001:Pkhd1	UTSW	1	20222906	missense	possibly damaging	0.51
R0063:Pkhd1	UTSW	1	20211950	missense	probably benign	0.02
R0063:Pkhd1	UTSW	1	20211950	missense	probably benign	0.02
R0071:Pkhd1	UTSW	1	20201344	missense	probably benign	0.11
R0071:Pkhd1	UTSW	1	20201344	missense	probably benign	0.11
R0094:Pkhd1	UTSW	1	20209246	missense	probably damaging	1.00
R0094:Pkhd1	UTSW	1	20209246	missense	probably damaging	1.00
R0103:Pkhd1	UTSW	1	20523359	missense	probably benign	0.04
R0103:Pkhd1	UTSW	1	20523359	missense	probably benign	0.04
R0105:Pkhd1	UTSW	1	20523732	nonsense	probably null
R0105:Pkhd1	UTSW	1	20523732	nonsense	probably null
R0115:Pkhd1	UTSW	1	20350490	missense	probably damaging	1.00
R0193:Pkhd1	UTSW	1	20358917	missense	probably damaging	1.00
R0245:Pkhd1	UTSW	1	20540400	missense	probably benign	0.03
R0277:Pkhd1	UTSW	1	20275538	missense	probably benign	0.04
R0310:Pkhd1	UTSW	1	20549822	splice site	probably null
R0323:Pkhd1	UTSW	1	20275538	missense	probably benign	0.04
R0395:Pkhd1	UTSW	1	20381547	missense	probably benign	0.26
R0412:Pkhd1	UTSW	1	20117788	missense	probably damaging	1.00
R0506:Pkhd1	UTSW	1	20559469	missense	probably benign	0.00
R0512:Pkhd1	UTSW	1	20310514	splice site	probably benign
R0550:Pkhd1	UTSW	1	20347223	missense	probably null	1.00
R0584:Pkhd1	UTSW	1	20239436	nonsense	probably null
R0586:Pkhd1	UTSW	1	20524111	missense	probably benign	0.04
R0598:Pkhd1	UTSW	1	20200890	missense	probably damaging	1.00
R0603:Pkhd1	UTSW	1	20117173	missense	probably benign	0.05
R0634:Pkhd1	UTSW	1	20117474	missense	probably damaging	1.00
R0677:Pkhd1	UTSW	1	20524230	missense	probably benign	0.01
R0746:Pkhd1	UTSW	1	20198107	missense	probably damaging	1.00
R0781:Pkhd1	UTSW	1	20117484	missense	probably benign	0.01
R0840:Pkhd1	UTSW	1	20350521	missense	probably damaging	0.98
R0946:Pkhd1	UTSW	1	20199381	missense	probably benign	0.10
R1018:Pkhd1	UTSW	1	20201259	missense	possibly damaging	0.89
R1028:Pkhd1	UTSW	1	20117726	missense	probably damaging	1.00
R1136:Pkhd1	UTSW	1	20522829	missense	possibly damaging	0.68
R1178:Pkhd1	UTSW	1	20585157	critical splice donor site	probably null
R1180:Pkhd1	UTSW	1	20585157	critical splice donor site	probably null
R1222:Pkhd1	UTSW	1	20567456	missense	probably benign	0.07
R1334:Pkhd1	UTSW	1	20533905	missense	possibly damaging	0.81
R1335:Pkhd1	UTSW	1	20571405	missense	probably damaging	1.00
R1387:Pkhd1	UTSW	1	20555223	splice site	probably benign
R1411:Pkhd1	UTSW	1	20373896	missense	probably damaging	1.00
R1443:Pkhd1	UTSW	1	20534558	missense	probably damaging	1.00
R1448:Pkhd1	UTSW	1	20585157	critical splice donor site	probably null
R1468:Pkhd1	UTSW	1	20523341	missense	probably damaging	1.00
R1468:Pkhd1	UTSW	1	20523341	missense	probably damaging	1.00
R1473:Pkhd1	UTSW	1	20522983	missense	probably benign	0.00
R1524:Pkhd1	UTSW	1	20117780	missense	probably damaging	1.00
R1532:Pkhd1	UTSW	1	20117401	missense	probably benign	0.08
R1565:Pkhd1	UTSW	1	20347457	missense	probably damaging	1.00
R1572:Pkhd1	UTSW	1	20347440	missense	probably benign	0.02
R1583:Pkhd1	UTSW	1	20117825	missense	probably benign
R1617:Pkhd1	UTSW	1	20198050	missense	possibly damaging	0.95
R1631:Pkhd1	UTSW	1	20522897	missense	probably benign	0.06
R1655:Pkhd1	UTSW	1	20584129	missense	probably damaging	1.00
R1707:Pkhd1	UTSW	1	20550840	splice site	probably benign
R1753:Pkhd1	UTSW	1	20533905	missense	possibly damaging	0.81
R1782:Pkhd1	UTSW	1	20565711	missense	probably damaging	0.98
R1822:Pkhd1	UTSW	1	20347457	missense	probably damaging	1.00
R1823:Pkhd1	UTSW	1	20347457	missense	probably damaging	1.00
R1824:Pkhd1	UTSW	1	20347457	missense	probably damaging	1.00
R1836:Pkhd1	UTSW	1	20117069	missense	probably benign	0.01
R1862:Pkhd1	UTSW	1	20551020	missense	probably benign	0.00
R1863:Pkhd1	UTSW	1	20551020	missense	probably benign	0.00
R1869:Pkhd1	UTSW	1	20615267	critical splice donor site	probably null
R1913:Pkhd1	UTSW	1	20566756	critical splice donor site	probably null
R1928:Pkhd1	UTSW	1	20081300	splice site	probably benign
R1969:Pkhd1	UTSW	1	20381523	missense	probably damaging	1.00
R1970:Pkhd1	UTSW	1	20381523	missense	probably damaging	1.00
R1981:Pkhd1	UTSW	1	20117060	missense	probably benign	0.00
R2008:Pkhd1	UTSW	1	20199459	missense	probably damaging	0.99
R2034:Pkhd1	UTSW	1	20200669	missense	probably damaging	1.00
R2061:Pkhd1	UTSW	1	20612812	missense	possibly damaging	0.76
R2062:Pkhd1	UTSW	1	20201335	missense	probably damaging	0.97
R2108:Pkhd1	UTSW	1	20553574	nonsense	probably null
R2142:Pkhd1	UTSW	1	20523895	missense	probably benign	0.00
R2148:Pkhd1	UTSW	1	20414220	critical splice donor site	probably null
R2176:Pkhd1	UTSW	1	20553517	missense	probably damaging	1.00
R2202:Pkhd1	UTSW	1	20537360	missense	probably benign	0.06
R2255:Pkhd1	UTSW	1	20565639	missense	probably benign	0.23
R2269:Pkhd1	UTSW	1	20534535	critical splice donor site	probably null
R2275:Pkhd1	UTSW	1	20200849	missense	possibly damaging	0.95
R2340:Pkhd1	UTSW	1	20200855	missense	probably damaging	1.00
R2431:Pkhd1	UTSW	1	20201165	missense	possibly damaging	0.63
R2679:Pkhd1	UTSW	1	20209182	missense	probably benign	0.03
R2850:Pkhd1	UTSW	1	20509076	missense	possibly damaging	0.89
R2851:Pkhd1	UTSW	1	20058302	missense	probably benign	0.16
R2853:Pkhd1	UTSW	1	20058302	missense	probably benign	0.16
R2984:Pkhd1	UTSW	1	20222961	missense	possibly damaging	0.84
R2987:Pkhd1	UTSW	1	20104599	missense	possibly damaging	0.87
R3692:Pkhd1	UTSW	1	20555129	missense	possibly damaging	0.87
R3721:Pkhd1	UTSW	1	20585655	missense	probably benign	0.08
R3746:Pkhd1	UTSW	1	20058300	makesense	probably null
R3838:Pkhd1	UTSW	1	20534629	missense	possibly damaging	0.66
R3843:Pkhd1	UTSW	1	20558723	missense	probably benign	0.00
R3861:Pkhd1	UTSW	1	20200927	missense	probably damaging	1.00
R3893:Pkhd1	UTSW	1	20312138	nonsense	probably null
R3926:Pkhd1	UTSW	1	20550873	missense	probably benign	0.00
R4183:Pkhd1	UTSW	1	20117807	missense	probably benign	0.03
R4184:Pkhd1	UTSW	1	20209277	missense	probably benign	0.03
R4184:Pkhd1	UTSW	1	20563686	missense	probably benign	0.06
R4255:Pkhd1	UTSW	1	20593934	missense	probably damaging	0.99
R4275:Pkhd1	UTSW	1	20058384	missense	probably benign	0.00
R4342:Pkhd1	UTSW	1	20058617	missense	probably benign	0.00
R4386:Pkhd1	UTSW	1	20414292	missense	probably benign	0.00
R4402:Pkhd1	UTSW	1	20239411	missense	probably damaging	1.00
R4431:Pkhd1	UTSW	1	20523314	missense	probably damaging	0.99
R4560:Pkhd1	UTSW	1	20211858	missense	probably damaging	1.00
R4561:Pkhd1	UTSW	1	20534719	missense	possibly damaging	0.89
R4570:Pkhd1	UTSW	1	20381523	missense	probably damaging	1.00
R4571:Pkhd1	UTSW	1	20613409	missense	probably damaging	1.00
R4588:Pkhd1	UTSW	1	20200868	missense	probably benign	0.00
R4598:Pkhd1	UTSW	1	20503056	missense	probably damaging	1.00
R4651:Pkhd1	UTSW	1	20381523	missense	probably damaging	1.00
R4657:Pkhd1	UTSW	1	20364167	missense	possibly damaging	0.89
R4718:Pkhd1	UTSW	1	20081228	missense	probably damaging	1.00
R4740:Pkhd1	UTSW	1	20524130	missense	probably benign
R4750:Pkhd1	UTSW	1	20524112	missense	possibly damaging	0.57
R4816:Pkhd1	UTSW	1	20199415	missense	probably damaging	0.99
R4825:Pkhd1	UTSW	1	20537401	missense	probably damaging	0.96
R4885:Pkhd1	UTSW	1	20070488	missense	possibly damaging	0.55
R4907:Pkhd1	UTSW	1	20209226	missense	probably damaging	1.00
R4944:Pkhd1	UTSW	1	20288205	missense	probably null	0.01
R5062:Pkhd1	UTSW	1	20585711	missense	probably benign	0.00
R5090:Pkhd1	UTSW	1	20200757	missense	probably damaging	1.00
R5104:Pkhd1	UTSW	1	20585191	missense	probably damaging	1.00
R5187:Pkhd1	UTSW	1	20209224	missense	possibly damaging	0.67
R5202:Pkhd1	UTSW	1	20547341	missense	probably benign	0.01
R5240:Pkhd1	UTSW	1	20275641	missense	probably benign	0.04
R5248:Pkhd1	UTSW	1	20534545	missense	probably benign	0.00
R5252:Pkhd1	UTSW	1	20350411	critical splice donor site	probably null
R5293:Pkhd1	UTSW	1	20509076	missense	possibly damaging	0.89
R5311:Pkhd1	UTSW	1	20565870	missense	possibly damaging	0.94
R5317:Pkhd1	UTSW	1	20450304	missense	probably damaging	1.00
R5346:Pkhd1	UTSW	1	20392097	missense	probably benign
R5346:Pkhd1	UTSW	1	20523434	missense	probably damaging	0.96
R5431:Pkhd1	UTSW	1	20117836	missense	probably benign	0.25
R5447:Pkhd1	UTSW	1	20239385	missense	probably benign	0.00
R5478:Pkhd1	UTSW	1	20201156	missense	probably damaging	1.00
R5497:Pkhd1	UTSW	1	20377404	missense	possibly damaging	0.94
R5554:Pkhd1	UTSW	1	20081252	missense	probably damaging	0.99
R5579:Pkhd1	UTSW	1	20523142	missense	probably damaging	0.96
R5614:Pkhd1	UTSW	1	20073526	missense	possibly damaging	0.83
R5648:Pkhd1	UTSW	1	20558626	missense	probably benign	0.04
R5651:Pkhd1	UTSW	1	20117807	missense	probably benign	0.03
R5665:Pkhd1	UTSW	1	20588531	missense	probably damaging	1.00
R5681:Pkhd1	UTSW	1	20547461	missense	possibly damaging	0.61
R5754:Pkhd1	UTSW	1	20523651	nonsense	probably null
R5760:Pkhd1	UTSW	1	20073554	missense	probably benign	0.02
R5776:Pkhd1	UTSW	1	20209185	missense	possibly damaging	0.62
R5782:Pkhd1	UTSW	1	20058600	missense	probably benign
R5810:Pkhd1	UTSW	1	20200673	missense	probably benign	0.26
R5814:Pkhd1	UTSW	1	20199405	missense	probably damaging	1.00
R5816:Pkhd1	UTSW	1	20058678	missense	probably benign	0.03
R5835:Pkhd1	UTSW	1	20201083	missense	probably benign	0.01
R5844:Pkhd1	UTSW	1	20381461	missense	probably benign	0.00
R5847:Pkhd1	UTSW	1	20374736	nonsense	probably null
R5852:Pkhd1	UTSW	1	20377408	missense	probably benign	0.22
R5863:Pkhd1	UTSW	1	20520210	missense	possibly damaging	0.63
R6213:Pkhd1	UTSW	1	20523770	missense	possibly damaging	0.80
R6351:Pkhd1	UTSW	1	20211951	missense	probably benign	0.00
R6386:Pkhd1	UTSW	1	20551020	missense	probably damaging	0.96
R6542:Pkhd1	UTSW	1	20585703	missense	probably benign	0.02
R6579:Pkhd1	UTSW	1	20200823	missense	probably benign	0.01
R6658:Pkhd1	UTSW	1	20612705	missense	probably damaging	1.00
R6765:Pkhd1	UTSW	1	20058339	missense	probably benign
R6886:Pkhd1	UTSW	1	20347280	missense	probably benign	0.01
R6892:Pkhd1	UTSW	1	20523515	missense	probably damaging	1.00
R6900:Pkhd1	UTSW	1	20534701	missense	probably benign	0.06
R6932:Pkhd1	UTSW	1	20562451	missense	probably benign	0.19
R7191:Pkhd1	UTSW	1	20558719	missense	probably benign	0.00
R7220:Pkhd1	UTSW	1	20523126	missense	possibly damaging	0.89
R7329:Pkhd1	UTSW	1	20547519	missense	probably damaging	0.96
R7361:Pkhd1	UTSW	1	20593953	missense	probably damaging	1.00
R7381:Pkhd1	UTSW	1	20200973	missense	probably damaging	1.00
R7388:Pkhd1	UTSW	1	20239304	missense	not run
R7436:Pkhd1	UTSW	1	20200701	missense	probably benign
R7473:Pkhd1	UTSW	1	20549756	missense	probably damaging	0.99
R7578:Pkhd1	UTSW	1	20347361	missense	probably damaging	1.00
R7751:Pkhd1	UTSW	1	20200925	missense	probably damaging	1.00
R7755:Pkhd1	UTSW	1	20547493	missense	probably damaging	0.98
R7757:Pkhd1	UTSW	1	20562415	missense	probably damaging	1.00
R7832:Pkhd1	UTSW	1	20502999	missense	probably damaging	1.00
R7834:Pkhd1	UTSW	1	20312049	missense	probably benign
R7920:Pkhd1	UTSW	1	20275535	missense	probably damaging	1.00
R8014:Pkhd1	UTSW	1	20508891	critical splice donor site	probably null
R8034:Pkhd1	UTSW	1	20381438	missense	possibly damaging	0.94
R8085:Pkhd1	UTSW	1	20613415	missense	probably damaging	1.00
R8087:Pkhd1	UTSW	1	20523089	missense	probably damaging	1.00
R8103:Pkhd1	UTSW	1	20200757	missense	probably damaging	1.00
R8122:Pkhd1	UTSW	1	20562458	missense	probably damaging	1.00
R8273:Pkhd1	UTSW	1	20537420	splice site	probably benign
R8485:Pkhd1	UTSW	1	20523033	missense	probably damaging	1.00
R8504:Pkhd1	UTSW	1	20520208	missense	probably benign	0.10
R8544:Pkhd1	UTSW	1	20522975	missense	probably damaging	1.00
R8692:Pkhd1	UTSW	1	20392150	missense	probably damaging	1.00
R8787:Pkhd1	UTSW	1	20288237	missense	probably damaging	0.99
R8853:Pkhd1	UTSW	1	20073455	critical splice donor site	probably null
R8907:Pkhd1	UTSW	1	20117561	missense	possibly damaging	0.88
R8934:Pkhd1	UTSW	1	20392010	critical splice donor site	probably null
R8990:Pkhd1	UTSW	1	20347305	missense	probably benign	0.00
R8998:Pkhd1	UTSW	1	20364201	missense	probably damaging	1.00
R9024:Pkhd1	UTSW	1	20522751	missense	probably benign	0.24
R9035:Pkhd1	UTSW	1	20502952	missense	probably damaging	1.00
R9092:Pkhd1	UTSW	1	20562362	missense	probably benign	0.00
R9238:Pkhd1	UTSW	1	20534575	missense	possibly damaging	0.89
R9258:Pkhd1	UTSW	1	20373950	missense	probably damaging	0.99
R9262:Pkhd1	UTSW	1	20548127	missense	probably benign	0.01
R9297:Pkhd1	UTSW	1	20222894	missense	probably benign	0.06
R9452:Pkhd1	UTSW	1	20612729	missense	possibly damaging	0.77
R9515:Pkhd1	UTSW	1	20567517	missense	probably damaging	1.00
R9540:Pkhd1	UTSW	1	20199346	missense	probably benign	0.00
R9542:Pkhd1	UTSW	1	20117780	missense	probably damaging	1.00
R9629:Pkhd1	UTSW	1	20392213	missense	possibly damaging	0.63
R9644:Pkhd1	UTSW	1	20547466	missense	probably benign	0.04
R9739:Pkhd1	UTSW	1	20350484	missense	probably damaging	1.00
R9767:Pkhd1	UTSW	1	20414412	missense	probably benign
R9781:Pkhd1	UTSW	1	20117441	missense	possibly damaging	0.95
R9803:Pkhd1	UTSW	1	20566849	missense	probably damaging	1.00
X0012:Pkhd1	UTSW	1	20373926	missense	probably damaging	1.00
X0067:Pkhd1	UTSW	1	20520226	missense	probably damaging	1.00
Z1176:Pkhd1	UTSW	1	20523747	missense	possibly damaging	0.81
Z1177:Pkhd1	UTSW	1	20117883	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20310594	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20523621	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20523938	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20551019	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACCACACTTTGACTGAAGGG -3'
(R):5'- CATGAGAGAAATTGCAGGCTTG -3'

Sequencing Primer
(F):5'- CCACACTTTGACTGAAGGGCTTAAAG -3'
(R):5'- TTGCAGGCTTGAACAGTAAGG -3'

Posted On

2014-06-23