Incidental Mutation 'R0090:Myh6'
ID20173
Institutional Source Beutler Lab
Gene Symbol Myh6
Ensembl Gene ENSMUSG00000040752
Gene Namemyosin, heavy polypeptide 6, cardiac muscle, alpha
Synonymsalpha myosin, A830009F23Rik, alpha cardiac MHC, cardiomyopathy, hypertrophic 1, Myhca, Myhc-a, alpha-MHC
MMRRC Submission 038377-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0090 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location54941921-54966927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54958704 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 546 (D546G)
Ref Sequence ENSEMBL: ENSMUSP00000154634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081857] [ENSMUST00000226297]
Predicted Effect probably damaging
Transcript: ENSMUST00000081857
AA Change: D546G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080538
Gene: ENSMUSG00000040752
AA Change: D546G

DomainStartEndE-ValueType
Pfam:Myosin_N 34 73 1.9e-15 PFAM
MYSc 79 781 N/A SMART
IQ 782 804 1.15e-1 SMART
IQ 808 830 3.32e2 SMART
Pfam:Myosin_tail_1 845 1926 2.1e-162 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131892
Predicted Effect probably damaging
Transcript: ENSMUST00000226297
AA Change: D546G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Meta Mutation Damage Score 0.9180 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.7%
  • 20x: 91.4%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cardiac muscle myosin is a hexamer consisting of two heavy chain subunits, two light chain subunits, and two regulatory subunits. This gene encodes the alpha heavy chain subunit of cardiac myosin. The gene is located approximately 4kb downstream of the gene encoding the beta heavy chain subunit of cardiac myosin. Mutations in this gene cause familial hypertrophic cardiomyopathy and atrial septal defect 3. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality associated with heart defects while heterozygotes show cardiac myofibrillar disarray, cardiac dysfunction and fibrosis. Mice heterozygous for different knock-in alleles may develop hypertrophic or dilated forms of cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
4933427I04Rik A G 4: 123,860,982 T230A possibly damaging Het
9230110C19Rik T A 9: 8,027,183 N118I probably benign Het
Acsm1 T C 7: 119,662,189 probably benign Het
Acta1 T C 8: 123,893,657 N14S probably damaging Het
Aff4 A G 11: 53,392,782 T362A probably benign Het
Aggf1 A G 13: 95,364,959 I305T probably benign Het
Ap4b1 A G 3: 103,820,429 D325G possibly damaging Het
Ap4e1 C T 2: 127,064,985 T1055I possibly damaging Het
Arhgef2 A T 3: 88,639,348 Q496L probably damaging Het
Arhgef28 A G 13: 98,075,110 F122L probably damaging Het
Baiap3 G A 17: 25,250,070 probably benign Het
Casp8ap2 T A 4: 32,640,327 H460Q probably damaging Het
Casz1 A G 4: 148,933,411 T386A probably benign Het
Cd53 A T 3: 106,767,409 V114E possibly damaging Het
Celsr2 A G 3: 108,393,327 probably benign Het
Chaf1b G T 16: 93,887,124 A88S possibly damaging Het
Cldn10 A T 14: 118,874,200 Y194F probably damaging Het
Clec2e A C 6: 129,095,218 probably null Het
Cmpk2 A T 12: 26,478,022 T413S probably benign Het
Col9a1 T A 1: 24,223,562 probably null Het
Dchs1 G T 7: 105,755,932 Q2468K probably benign Het
Ddx60 A G 8: 61,942,293 D88G probably damaging Het
Dnah8 A G 17: 30,784,090 R3588G probably benign Het
Ect2 T C 3: 27,115,476 T774A probably benign Het
Ect2 C T 3: 27,138,502 E431K probably null Het
Ern1 A G 11: 106,405,823 V767A probably damaging Het
Fbln1 A C 15: 85,224,288 E75A possibly damaging Het
Fgf5 C T 5: 98,261,987 R132* probably null Het
Folh1 T C 7: 86,725,868 probably benign Het
Gdf15 A T 8: 70,629,684 H257Q probably damaging Het
Ghitm T C 14: 37,122,219 T322A probably benign Het
Gm13212 A T 4: 145,622,625 K211* probably null Het
Gm5709 A G 3: 59,618,771 noncoding transcript Het
Hbb-y C T 7: 103,852,743 probably null Het
Hmcn2 A T 2: 31,426,198 D3771V probably damaging Het
Hspa12a T C 19: 58,799,509 D627G probably benign Het
Idh2 T C 7: 80,097,914 E286G probably damaging Het
Idh3b C A 2: 130,280,979 A297S probably benign Het
Igsf3 A G 3: 101,435,652 E535G probably damaging Het
Ilf3 T A 9: 21,395,414 D314E probably damaging Het
Itgb8 A G 12: 119,202,563 S78P probably benign Het
Itih5 G A 2: 10,164,684 V31I probably benign Het
Kcnj2 T C 11: 111,073,027 V415A probably benign Het
Kin A G 2: 10,085,773 Q53R possibly damaging Het
Krt78 A T 15: 101,947,837 M513K probably benign Het
Krtap4-8 A T 11: 99,780,486 probably benign Het
Ltbr T C 6: 125,309,449 probably benign Het
Mgat4a G A 1: 37,490,333 T146I probably damaging Het
Mrps2 G C 2: 28,468,256 W19C probably damaging Het
Mthfs T C 9: 89,211,291 S33P probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Ndst2 T C 14: 20,727,267 T553A probably damaging Het
Nlrp12 T C 7: 3,240,034 E616G probably damaging Het
Nrde2 T C 12: 100,129,286 probably benign Het
Nup210l G A 3: 90,211,779 V1832I probably benign Het
Olfr1283 A T 2: 111,369,294 I221F probably damaging Het
Olfr376 G A 11: 73,375,576 V276I probably benign Het
Pcm1 A T 8: 41,256,041 E9D probably damaging Het
Pear1 A T 3: 87,754,342 D541E possibly damaging Het
Peg10 A G 6: 4,756,063 probably benign Het
Prss1 G A 6: 41,461,232 R31Q probably benign Het
Ptpn13 T C 5: 103,569,503 V1837A probably damaging Het
Rasgrp3 A G 17: 75,498,461 D149G probably damaging Het
Reg3d A T 6: 78,378,483 H8Q possibly damaging Het
Rhox4f A C X: 37,607,469 V15G probably benign Het
Sacs T A 14: 61,205,440 L1645H probably damaging Het
Slc16a5 A T 11: 115,464,925 S71C probably damaging Het
Slc9a3 A G 13: 74,158,728 E324G probably damaging Het
Smgc T C 15: 91,859,762 V574A possibly damaging Het
Stac3 C T 10: 127,503,930 probably benign Het
Supv3l1 A G 10: 62,429,706 L685P probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tas2r125 G T 6: 132,910,398 A250S probably benign Het
Tdrd6 C T 17: 43,628,241 V639I probably benign Het
Thap12 T G 7: 98,715,893 W423G probably damaging Het
Tmem245 T C 4: 56,899,410 I217V probably benign Het
Trip12 T A 1: 84,732,136 probably benign Het
Tshz3 T C 7: 36,768,892 V102A probably benign Het
Ubap1 T C 4: 41,379,826 S347P probably damaging Het
Usp10 C T 8: 119,953,196 Q612* probably null Het
Vmn2r72 T C 7: 85,754,876 I36V probably benign Het
Vps37a T C 8: 40,526,989 I63T possibly damaging Het
Whrn C A 4: 63,432,732 R9L possibly damaging Het
Xrcc1 T C 7: 24,570,217 Y401H probably damaging Het
Ylpm1 GCCTAAGCAGCAACCTAAG GCCTAAG 12: 85,029,040 probably benign Het
Zfhx3 G A 8: 108,950,057 D2580N possibly damaging Het
Zfhx4 A G 3: 5,243,625 N637S probably damaging Het
Zyg11a A T 4: 108,201,347 probably benign Het
Other mutations in Myh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Myh6 APN 14 54946993 missense probably benign 0.13
IGL00401:Myh6 APN 14 54953417 missense probably benign 0.00
IGL01062:Myh6 APN 14 54952292 missense probably damaging 0.99
IGL01300:Myh6 APN 14 54963091 missense possibly damaging 0.94
IGL01688:Myh6 APN 14 54963960 missense possibly damaging 0.74
IGL01695:Myh6 APN 14 54957413 missense probably benign 0.01
IGL01762:Myh6 APN 14 54962081 missense probably benign 0.17
IGL01803:Myh6 APN 14 54944543 missense probably damaging 1.00
IGL02079:Myh6 APN 14 54950541 missense probably damaging 1.00
IGL02315:Myh6 APN 14 54953834 missense probably damaging 1.00
IGL02340:Myh6 APN 14 54957155 missense possibly damaging 0.76
IGL02377:Myh6 APN 14 54944318 missense probably benign 0.10
IGL02715:Myh6 APN 14 54946908 unclassified probably benign
IGL02742:Myh6 APN 14 54953924 missense possibly damaging 0.62
P0028:Myh6 UTSW 14 54963637 missense probably benign
PIT4520001:Myh6 UTSW 14 54950124 missense probably benign 0.00
R0058:Myh6 UTSW 14 54963404 missense probably damaging 1.00
R0360:Myh6 UTSW 14 54948347 nonsense probably null
R0364:Myh6 UTSW 14 54948347 nonsense probably null
R0395:Myh6 UTSW 14 54946320 missense possibly damaging 0.94
R0549:Myh6 UTSW 14 54958608 missense probably damaging 1.00
R0559:Myh6 UTSW 14 54958554 missense probably benign
R0800:Myh6 UTSW 14 54953278 splice site probably benign
R0892:Myh6 UTSW 14 54947054 missense probably benign 0.17
R0975:Myh6 UTSW 14 54953369 missense probably damaging 1.00
R1051:Myh6 UTSW 14 54949527 missense probably benign 0.12
R1180:Myh6 UTSW 14 54944468 missense possibly damaging 0.93
R1311:Myh6 UTSW 14 54946365 missense probably damaging 0.96
R1490:Myh6 UTSW 14 54962718 nonsense probably null
R1531:Myh6 UTSW 14 54956506 missense probably damaging 1.00
R1835:Myh6 UTSW 14 54957401 missense probably benign 0.03
R1845:Myh6 UTSW 14 54944674 missense probably damaging 1.00
R2033:Myh6 UTSW 14 54963645 missense probably benign 0.00
R2143:Myh6 UTSW 14 54952954 missense probably damaging 1.00
R2146:Myh6 UTSW 14 54953771 missense probably damaging 1.00
R2155:Myh6 UTSW 14 54953794 missense probably benign
R2484:Myh6 UTSW 14 54961242 nonsense probably null
R3155:Myh6 UTSW 14 54944668 missense probably damaging 0.97
R3156:Myh6 UTSW 14 54944668 missense probably damaging 0.97
R3780:Myh6 UTSW 14 54963958 missense probably benign 0.00
R3906:Myh6 UTSW 14 54956955 missense probably benign 0.04
R3937:Myh6 UTSW 14 54963055 missense probably benign 0.00
R3938:Myh6 UTSW 14 54963055 missense probably benign 0.00
R4236:Myh6 UTSW 14 54960362 missense probably benign 0.15
R4373:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4374:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4377:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4798:Myh6 UTSW 14 54953293 missense probably damaging 1.00
R4844:Myh6 UTSW 14 54947194 missense possibly damaging 0.89
R4908:Myh6 UTSW 14 54956962 missense probably damaging 1.00
R5256:Myh6 UTSW 14 54952661 missense probably damaging 1.00
R5277:Myh6 UTSW 14 54956562 missense probably benign 0.01
R5356:Myh6 UTSW 14 54953762 missense probably damaging 1.00
R5433:Myh6 UTSW 14 54953924 missense probably benign 0.32
R5616:Myh6 UTSW 14 54956581 missense probably benign 0.17
R5784:Myh6 UTSW 14 54953064 missense possibly damaging 0.93
R5820:Myh6 UTSW 14 54958680 missense probably damaging 0.99
R5835:Myh6 UTSW 14 54950407 missense probably damaging 1.00
R5922:Myh6 UTSW 14 54946474 missense probably damaging 0.99
R5975:Myh6 UTSW 14 54950508 missense probably benign 0.31
R5988:Myh6 UTSW 14 54965394 missense probably damaging 1.00
R6630:Myh6 UTSW 14 54942001 missense probably benign 0.01
R6845:Myh6 UTSW 14 54944749 missense probably benign
R7009:Myh6 UTSW 14 54952292 missense probably damaging 0.99
R7154:Myh6 UTSW 14 54960307 missense probably benign 0.43
R7293:Myh6 UTSW 14 54947174 missense probably benign 0.00
R7313:Myh6 UTSW 14 54960270 missense probably benign 0.00
R7339:Myh6 UTSW 14 54961568 intron probably null
R7348:Myh6 UTSW 14 54952259 missense probably damaging 1.00
R7487:Myh6 UTSW 14 54953496 nonsense probably null
R7680:Myh6 UTSW 14 54948733 missense possibly damaging 0.88
R7726:Myh6 UTSW 14 54965365 missense probably damaging 0.99
Z1088:Myh6 UTSW 14 54956997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGAGTGTGTGCCTCCCTTCTTG -3'
(R):5'- ACCTTTGACCCTTCAGCAGTGCAG -3'

Sequencing Primer
(F):5'- GGAGGACTTCTGGTACAAACCC -3'
(R):5'- TCCTTGCTCTATGCTGTCAG -3'
Posted On2013-04-11