Mutagenetix > Incidental Mutation

Incidental Mutation 'R1791:Akap6'

201756

Institutional Source

Beutler Lab

Gene Symbol

Akap6

Ensembl Gene

ENSMUSG00000061603

Gene Name

A kinase (PRKA) anchor protein 6

Synonyms

MMRRC Submission

039821-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.868) question?

Stock #

R1791 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52699383-53155599 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 53069125 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1004 (S1004P)

Ref Sequence

ENSEMBL: ENSMUSP00000151871 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]

AlphaFold

E9Q9K8

Predicted Effect

probably damaging
Transcript: ENSMUST00000095737
AA Change: S1004P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: S1004P

Domain	Start	End	E-Value	Type
low complexity region	34	51	N/A	INTRINSIC
Blast:SPEC	66	168	2e-50	BLAST
low complexity region	441	455	N/A	INTRINSIC
low complexity region	544	555	N/A	INTRINSIC
low complexity region	569	587	N/A	INTRINSIC
low complexity region	640	651	N/A	INTRINSIC
low complexity region	694	708	N/A	INTRINSIC
SPEC	779	880	1.06e-1	SMART
SPEC	959	1057	1.45e0	SMART
SPEC	1078	1185	2.56e-2	SMART
low complexity region	1316	1332	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1610	1622	N/A	INTRINSIC
low complexity region	1683	1698	N/A	INTRINSIC
low complexity region	1737	1781	N/A	INTRINSIC
low complexity region	1899	1910	N/A	INTRINSIC
low complexity region	2019	2031	N/A	INTRINSIC
low complexity region	2104	2115	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000219786
AA Change: S1004P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.1717

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.6%

Validation Efficiency

95% (104/110)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	C	A	6: 121,654,612	L623M	probably benign	Het
Akap13	T	G	7: 75,611,035	C333G	probably benign	Het
Akap7	T	C	10: 25,239,685	T181A	probably benign	Het
Ap3b1	A	G	13: 94,408,797	E186G	possibly damaging	Het
Arhgap17	T	C	7: 123,286,702	T736A	probably benign	Het
Bmp8a	G	T	4: 123,324,585	R214S	possibly damaging	Het
Cacna1f	T	C	X: 7,620,439	S890P	probably damaging	Het
Cd96	A	T	16: 46,117,999	Y34*	probably null	Het
Cdc42ep4	A	G	11: 113,729,337	L76P	probably damaging	Het
Cdh23	A	G	10: 60,391,726	V1195A	possibly damaging	Het
Cfap57	G	A	4: 118,571,724	T1015M	possibly damaging	Het
Chrm3	C	A	13: 9,877,416	G528V	probably damaging	Het
Clip4	T	C	17: 71,801,942		probably benign	Het
Col9a1	A	T	1: 24,185,305	R189S	unknown	Het
Cul4b	A	T	X: 38,547,851	I481N	probably damaging	Het
Cyp26b1	A	G	6: 84,584,459	S74P	probably benign	Het
Cyp3a57	A	G	5: 145,371,010	N192S	probably benign	Het
Dcbld1	A	G	10: 52,319,476	D260G	probably damaging	Het
Dhrs7	T	C	12: 72,653,165	N231S	probably benign	Het
Disp3	G	A	4: 148,241,518	P1261L	probably damaging	Het
Dyx1c1	T	C	9: 72,960,684	Y76H	possibly damaging	Het
Eml5	C	A	12: 98,887,056	V95F	probably benign	Het
Emsy	A	G	7: 98,647,880	I32T	probably damaging	Het
Esr1	A	G	10: 4,783,913	R238G	probably damaging	Het
Exosc1	T	C	19: 41,928,085	K84R	probably benign	Het
F830016B08Rik	T	A	18: 60,300,517	V224E	probably benign	Het
Fam228a	T	A	12: 4,732,748	N115I	probably damaging	Het
Farp1	T	C	14: 121,256,745	I546T	probably damaging	Het
Fbxo30	T	A	10: 11,289,787	C84*	probably null	Het
Fbxw17	A	G	13: 50,425,774		probably benign	Het
Foxo4	G	C	X: 101,258,463	R192P	probably benign	Het
Galnt7	G	T	8: 57,542,530	T377K	probably benign	Het
Garnl3	T	C	2: 33,034,127	I248V	probably benign	Het
Glod4	A	G	11: 76,237,708	Y104H	probably damaging	Het
Glrb	T	C	3: 80,860,175	Y246C	probably damaging	Het
Gm5292	A	G	5: 43,944,410		noncoding transcript	Het
Gm5424	C	A	10: 62,072,307		noncoding transcript	Het
Gm7276	C	T	18: 77,185,735		probably benign	Het
Gm9774	T	A	3: 92,428,231	D388V	probably damaging	Het
Golga5	A	G	12: 102,492,131	N611S	possibly damaging	Het
Gucy2c	A	C	6: 136,744,027	Y391D	probably damaging	Het
H6pd	A	G	4: 149,981,673	I760T	probably damaging	Het
Hapln2	T	A	3: 88,024,405	I5F	possibly damaging	Het
Hdac11	G	T	6: 91,168,824	V169L	probably benign	Het
Hectd2	T	C	19: 36,609,416	V557A	possibly damaging	Het
Huwe1	T	A	X: 151,864,753	N747K	probably benign	Het
Ints1	A	G	5: 139,774,522	S66P	probably benign	Het
Ipo7	A	G	7: 110,027,132	D49G	probably damaging	Het
Itgb4	G	A	11: 115,988,520	C575Y	probably damaging	Het
Klhl3	A	G	13: 58,033,230	V250A	possibly damaging	Het
Klk1b24	A	G	7: 44,190,428		probably null	Het
Map3k11	T	A	19: 5,695,572	Y333*	probably null	Het
Mbp	A	G	18: 82,554,349	T57A	probably benign	Het
Myh9	A	G	15: 77,773,264		probably benign	Het
Mypn	C	T	10: 63,125,693	R1040Q	probably damaging	Het
Ncdn	A	G	4: 126,751,939		probably null	Het
Ndn	C	T	7: 62,348,508	P34L	probably benign	Het
Odf3l1	A	T	9: 56,851,743	F43I	possibly damaging	Het
Olfr509	T	A	7: 108,646,364	T71S	probably benign	Het
Olfr566	G	A	7: 102,856,362	Q307*	probably null	Het
Olfr623	T	C	7: 103,660,798		probably null	Het
Olfr726	A	G	14: 50,084,042	F213S	probably benign	Het
Olfr749	AGGGATTGGG	AGGGATTGGGATTGGG	14: 50,736,687		probably benign	Het
Olfr924	T	A	9: 38,848,605	S164T	possibly damaging	Het
Pbx3	T	C	2: 34,224,452	T82A	possibly damaging	Het
Pi15	T	C	1: 17,602,721	F48S	probably benign	Het
Pkhd1	A	G	1: 20,585,152		probably benign	Het
Ppard	C	G	17: 28,286,374	R12G	unknown	Het
Prrc2c	G	T	1: 162,704,982		probably benign	Het
Prune1	A	G	3: 95,268,242	Y41H	possibly damaging	Het
Rcsd1	T	C	1: 165,655,972	D150G	probably damaging	Het
Rgs12	A	T	5: 34,966,112	Q413L	possibly damaging	Het
Rhox2h	A	G	X: 37,669,195	Y185H	probably damaging	Het
Rnf17	T	A	14: 56,504,007	C1306*	probably null	Het
Ros1	T	A	10: 52,100,087	M1499L	probably benign	Het
Rubcnl	T	C	14: 75,047,549	S503P	probably damaging	Het
Sap18b	A	T	8: 95,825,714	R117S	probably benign	Het
Shank2	A	G	7: 144,410,599	E858G	probably damaging	Het
Shtn1	T	C	19: 59,032,200	R197G	probably damaging	Het
Slamf8	G	A	1: 172,584,520	R163*	probably null	Het
Slc6a3	T	C	13: 73,566,292	I392T	possibly damaging	Het
Sp140	C	T	1: 85,620,051		probably benign	Het
Sp8	T	C	12: 118,849,016	V202A	possibly damaging	Het
Spata13	T	C	14: 60,709,459	V652A	probably damaging	Het
Stpg2	A	T	3: 139,317,401	T393S	probably benign	Het
Tagap	A	G	17: 7,933,545	T521A	probably benign	Het
Tagap	T	C	17: 7,931,467	M228T	probably damaging	Het
Tas2r123	T	G	6: 132,847,565	S142A	probably damaging	Het
Tat	T	A	8: 109,991,629	S49T	probably benign	Het
Tfap4	G	T	16: 4,552,069	Q41K	possibly damaging	Het
Thbs2	T	C	17: 14,685,813	N275S	probably benign	Het
Tnfsf14	T	A	17: 57,190,867	R122W	probably damaging	Het
Tnrc6a	T	C	7: 123,192,917	V1886A	possibly damaging	Het
Trim56	G	A	5: 137,114,398	A88V	probably damaging	Het
Trio	A	G	15: 27,841,756	Y1081H	probably damaging	Het
Tspear	T	A	10: 77,870,419	L341H	possibly damaging	Het
Ube2o	G	A	11: 116,541,494	T882I	probably benign	Het
Uhrf1bp1	T	A	17: 27,894,746	D1297E	probably damaging	Het
Upk3a	A	G	15: 85,020,614	T188A	possibly damaging	Het
Vmn1r79	A	C	7: 12,176,431	D80A	probably damaging	Het
Wls	C	A	3: 159,911,813	T375K	probably benign	Het
Wnt5a	T	C	14: 28,511,878	M1T	probably null	Het
Zcchc4	A	G	5: 52,796,590	E204G	probably damaging	Het
Zfp513	G	A	5: 31,200,334	P232S	possibly damaging	Het

Other mutations in Akap6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Akap6	APN	12	53140980	missense	possibly damaging	0.79
IGL00505:Akap6	APN	12	52887102	missense	possibly damaging	0.92
IGL01134:Akap6	APN	12	52937217	missense	probably damaging	0.96
IGL01458:Akap6	APN	12	52886818	nonsense	probably null
IGL01589:Akap6	APN	12	53139664	missense	probably damaging	1.00
IGL01592:Akap6	APN	12	53142142	missense	probably damaging	1.00
IGL01738:Akap6	APN	12	52886817	missense	probably damaging	0.99
IGL01867:Akap6	APN	12	52888008	missense	probably damaging	1.00
IGL02025:Akap6	APN	12	53140335	missense	probably benign
IGL02041:Akap6	APN	12	53140653	missense	probably damaging	1.00
IGL02058:Akap6	APN	12	53140555	missense	probably damaging	1.00
IGL02194:Akap6	APN	12	52886823	missense	probably benign	0.00
IGL02226:Akap6	APN	12	53010467	splice site	probably benign
IGL02323:Akap6	APN	12	53140429	missense	probably benign	0.00
IGL02449:Akap6	APN	12	53140188	missense	probably damaging	1.00
IGL02475:Akap6	APN	12	53139494	missense	probably benign	0.03
IGL02546:Akap6	APN	12	52880738	missense	probably damaging	1.00
IGL02547:Akap6	APN	12	53140696	missense	probably damaging	1.00
IGL02588:Akap6	APN	12	52886499	nonsense	probably null
IGL02608:Akap6	APN	12	53010606	missense	probably benign	0.39
IGL02884:Akap6	APN	12	52886622	missense	probably benign	0.00
IGL02945:Akap6	APN	12	52880837	missense	probably damaging	1.00
IGL03029:Akap6	APN	12	52886412	missense	probably damaging	1.00
IGL03129:Akap6	APN	12	53140306	missense	probably damaging	1.00
R0133:Akap6	UTSW	12	53139471	nonsense	probably null
R0166:Akap6	UTSW	12	53140924	missense	probably benign	0.04
R0189:Akap6	UTSW	12	53141254	missense	probably benign	0.41
R0532:Akap6	UTSW	12	52887983	missense	probably benign	0.00
R0632:Akap6	UTSW	12	52937148	missense	probably damaging	1.00
R0666:Akap6	UTSW	12	52911808	missense	probably damaging	1.00
R0723:Akap6	UTSW	12	53141902	missense	probably damaging	1.00
R0763:Akap6	UTSW	12	53142214	missense	possibly damaging	0.93
R0785:Akap6	UTSW	12	52886622	missense	probably benign	0.00
R0879:Akap6	UTSW	12	52880799	missense	probably damaging	1.00
R0880:Akap6	UTSW	12	53139508	missense	possibly damaging	0.93
R1033:Akap6	UTSW	12	53069222	missense	probably damaging	0.97
R1055:Akap6	UTSW	12	52880672	nonsense	probably null
R1199:Akap6	UTSW	12	52796190	missense	probably damaging	1.00
R1295:Akap6	UTSW	12	52887029	missense	probably damaging	1.00
R1389:Akap6	UTSW	12	53139520	missense	probably benign	0.15
R1471:Akap6	UTSW	12	53141496	missense	probably benign	0.05
R1483:Akap6	UTSW	12	52796087	missense	probably damaging	1.00
R1512:Akap6	UTSW	12	52937154	missense	probably damaging	1.00
R1648:Akap6	UTSW	12	53142006	nonsense	probably null
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1891:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1899:Akap6	UTSW	12	53141852	missense	possibly damaging	0.95
R1917:Akap6	UTSW	12	53104612	missense	probably benign	0.13
R1970:Akap6	UTSW	12	52938475	missense	probably damaging	0.96
R1987:Akap6	UTSW	12	53140795	missense	possibly damaging	0.78
R1988:Akap6	UTSW	12	53140795	missense	possibly damaging	0.78
R2153:Akap6	UTSW	12	53141404	missense	probably benign	0.03
R2567:Akap6	UTSW	12	52938373	missense	probably damaging	1.00
R2568:Akap6	UTSW	12	52887278	missense	possibly damaging	0.77
R3025:Akap6	UTSW	12	53140143	missense	probably benign
R3051:Akap6	UTSW	12	52887033	missense	probably damaging	1.00
R3195:Akap6	UTSW	12	53072457	nonsense	probably null
R3196:Akap6	UTSW	12	53072457	nonsense	probably null
R3426:Akap6	UTSW	12	52888034	missense	probably damaging	1.00
R3783:Akap6	UTSW	12	52880769	missense	probably damaging	1.00
R3934:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3936:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3967:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R3970:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R4042:Akap6	UTSW	12	53139379	critical splice acceptor site	probably null
R4095:Akap6	UTSW	12	53139462	missense	probably damaging	1.00
R4152:Akap6	UTSW	12	53140407	missense	probably benign	0.45
R4231:Akap6	UTSW	12	53141038	missense	probably damaging	1.00
R4232:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4233:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4234:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4235:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4236:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4475:Akap6	UTSW	12	53141643	missense	probably benign	0.00
R4513:Akap6	UTSW	12	52796004	missense	probably benign	0.03
R4686:Akap6	UTSW	12	52887623	frame shift	probably null
R4724:Akap6	UTSW	12	52795885	missense	possibly damaging	0.80
R4782:Akap6	UTSW	12	52887623	frame shift	probably null
R4852:Akap6	UTSW	12	53104675	missense	probably damaging	1.00
R5024:Akap6	UTSW	12	53142562	missense	probably benign	0.01
R5116:Akap6	UTSW	12	53141515	missense	probably benign	0.01
R5164:Akap6	UTSW	12	53142466	missense	probably benign
R5225:Akap6	UTSW	12	52886546	missense	probably damaging	1.00
R5269:Akap6	UTSW	12	53139843	missense	probably damaging	0.99
R5352:Akap6	UTSW	12	52796097	missense	probably damaging	1.00
R5496:Akap6	UTSW	12	53140653	missense	possibly damaging	0.87
R5551:Akap6	UTSW	12	52795964	missense	probably damaging	1.00
R5997:Akap6	UTSW	12	52937233	critical splice donor site	probably null
R6137:Akap6	UTSW	12	53140354	missense	probably damaging	1.00
R6151:Akap6	UTSW	12	53025792	missense	probably damaging	1.00
R6169:Akap6	UTSW	12	53142358	missense	probably benign
R6307:Akap6	UTSW	12	53141568	missense	possibly damaging	0.85
R6351:Akap6	UTSW	12	53142025	missense	probably damaging	0.98
R6479:Akap6	UTSW	12	53141169	missense	probably damaging	1.00
R6502:Akap6	UTSW	12	53140215	missense	probably damaging	1.00
R6760:Akap6	UTSW	12	53139778	missense	probably damaging	1.00
R6778:Akap6	UTSW	12	53025816	missense	probably damaging	1.00
R6837:Akap6	UTSW	12	53141262	missense	probably damaging	1.00
R6896:Akap6	UTSW	12	52887494	missense	probably benign	0.06
R6917:Akap6	UTSW	12	53069168	missense	probably null	0.97
R6983:Akap6	UTSW	12	52887653	missense	probably damaging	1.00
R7142:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7143:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7216:Akap6	UTSW	12	53140457	missense	probably benign	0.02
R7297:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7356:Akap6	UTSW	12	52911864	missense	probably damaging	1.00
R7378:Akap6	UTSW	12	53142574	missense	probably benign	0.00
R7382:Akap6	UTSW	12	53142171	missense	probably benign	0.00
R7498:Akap6	UTSW	12	53142705	nonsense	probably null
R7542:Akap6	UTSW	12	53069234	missense	probably damaging	1.00
R7589:Akap6	UTSW	12	53142063	nonsense	probably null
R7676:Akap6	UTSW	12	52886850	missense	possibly damaging	0.94
R7814:Akap6	UTSW	12	53140961	missense	probably benign	0.28
R7971:Akap6	UTSW	12	53139795	missense	probably damaging	1.00
R8039:Akap6	UTSW	12	53141676	missense	probably benign	0.00
R8425:Akap6	UTSW	12	52886621	missense	probably benign	0.00
R8747:Akap6	UTSW	12	53142216	missense	probably benign	0.01
R8885:Akap6	UTSW	12	53141536	missense	probably benign
R8956:Akap6	UTSW	12	53140344	missense	probably benign	0.00
R8989:Akap6	UTSW	12	52880871	missense	probably damaging	1.00
R9014:Akap6	UTSW	12	53139620	missense	possibly damaging	0.60
R9031:Akap6	UTSW	12	53142048	missense	probably benign	0.36
R9216:Akap6	UTSW	12	52880885	missense	probably benign	0.05
R9220:Akap6	UTSW	12	53140449	missense	possibly damaging	0.49
R9243:Akap6	UTSW	12	53141252	missense	probably benign	0.08
R9286:Akap6	UTSW	12	53072471	missense	possibly damaging	0.90
R9347:Akap6	UTSW	12	53069111	missense	probably damaging	1.00
R9475:Akap6	UTSW	12	53010552	missense	probably damaging	1.00
R9509:Akap6	UTSW	12	53142238	missense	probably damaging	0.99
R9523:Akap6	UTSW	12	52795889	missense	probably benign	0.02
R9600:Akap6	UTSW	12	52886558	missense	probably benign	0.04
R9612:Akap6	UTSW	12	52911907	missense	probably damaging	1.00
R9627:Akap6	UTSW	12	53104630	missense
R9666:Akap6	UTSW	12	53141535	missense	probably benign
R9784:Akap6	UTSW	12	53141070	missense	probably damaging	1.00
X0062:Akap6	UTSW	12	53142361	missense	probably benign	0.43
Z1176:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- AGCAGTGTTACTGGGTCACTC -3'
(R):5'- AGCTTGCTTGAGATGTAAGGAG -3'

Sequencing Primer
(F):5'- GTTACTGGGTCACTCAAGGTAACC -3'
(R):5'- GTGCCTCAAATTAGAAATCAGACAG -3'

Posted On

2014-06-23