Incidental Mutation 'R1791:Ap3b1'
ID 201765
Institutional Source Beutler Lab
Gene Symbol Ap3b1
Ensembl Gene ENSMUSG00000021686
Gene Name adaptor-related protein complex 3, beta 1 subunit
Synonyms AP-3, Hps2, beta3A, rim2, recombination induced mutation 2
MMRRC Submission 039821-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.320) question?
Stock # R1791 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 94495468-94702825 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 94545305 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 186 (E186G)
Ref Sequence ENSEMBL: ENSMUSP00000022196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022196]
AlphaFold Q9Z1T1
Predicted Effect possibly damaging
Transcript: ENSMUST00000022196
AA Change: E186G

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: E186G

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:Adaptin_N 39 586 1.2e-170 PFAM
Pfam:SEEEED 672 812 1.3e-27 PFAM
AP3B1_C 822 969 1.58e-78 SMART
Blast:B2 993 1103 2e-27 BLAST
Meta Mutation Damage Score 0.2475 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency 95% (104/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]
Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C A 6: 121,631,571 (GRCm39) L623M probably benign Het
Adrm1b T A 3: 92,335,538 (GRCm39) D388V probably damaging Het
Akap13 T G 7: 75,260,783 (GRCm39) C333G probably benign Het
Akap6 T C 12: 53,115,908 (GRCm39) S1004P probably damaging Het
Akap7 T C 10: 25,115,583 (GRCm39) T181A probably benign Het
Arhgap17 T C 7: 122,885,925 (GRCm39) T736A probably benign Het
Bltp3a T A 17: 28,113,720 (GRCm39) D1297E probably damaging Het
Bmp8a G T 4: 123,218,378 (GRCm39) R214S possibly damaging Het
Cacna1f T C X: 7,486,678 (GRCm39) S890P probably damaging Het
Cd96 A T 16: 45,938,362 (GRCm39) Y34* probably null Het
Cdc42ep4 A G 11: 113,620,163 (GRCm39) L76P probably damaging Het
Cdh23 A G 10: 60,227,505 (GRCm39) V1195A possibly damaging Het
Cfap57 G A 4: 118,428,921 (GRCm39) T1015M possibly damaging Het
Chrm3 C A 13: 9,927,452 (GRCm39) G528V probably damaging Het
Cimap1c A T 9: 56,759,027 (GRCm39) F43I possibly damaging Het
Clip4 T C 17: 72,108,937 (GRCm39) probably benign Het
Col9a1 A T 1: 24,224,386 (GRCm39) R189S unknown Het
Cul4b A T X: 37,636,728 (GRCm39) I481N probably damaging Het
Cyp26b1 A G 6: 84,561,441 (GRCm39) S74P probably benign Het
Cyp3a57 A G 5: 145,307,820 (GRCm39) N192S probably benign Het
Dcbld1 A G 10: 52,195,572 (GRCm39) D260G probably damaging Het
Dhrs7 T C 12: 72,699,939 (GRCm39) N231S probably benign Het
Disp3 G A 4: 148,325,975 (GRCm39) P1261L probably damaging Het
Dnaaf4 T C 9: 72,867,966 (GRCm39) Y76H possibly damaging Het
Eml5 C A 12: 98,853,315 (GRCm39) V95F probably benign Het
Emsy A G 7: 98,297,087 (GRCm39) I32T probably damaging Het
Esr1 A G 10: 4,733,913 (GRCm39) R238G probably damaging Het
Exosc1 T C 19: 41,916,524 (GRCm39) K84R probably benign Het
F830016B08Rik T A 18: 60,433,589 (GRCm39) V224E probably benign Het
Fam228a T A 12: 4,782,748 (GRCm39) N115I probably damaging Het
Farp1 T C 14: 121,494,157 (GRCm39) I546T probably damaging Het
Fbxo30 T A 10: 11,165,531 (GRCm39) C84* probably null Het
Fbxw17 A G 13: 50,579,810 (GRCm39) probably benign Het
Foxo4 G C X: 100,302,069 (GRCm39) R192P probably benign Het
Galnt7 G T 8: 57,995,564 (GRCm39) T377K probably benign Het
Garnl3 T C 2: 32,924,139 (GRCm39) I248V probably benign Het
Glod4 A G 11: 76,128,534 (GRCm39) Y104H probably damaging Het
Glrb T C 3: 80,767,482 (GRCm39) Y246C probably damaging Het
Gm5292 A G 5: 44,101,752 (GRCm39) noncoding transcript Het
Gm5424 C A 10: 61,908,086 (GRCm39) noncoding transcript Het
Gm7276 C T 18: 77,273,431 (GRCm39) probably benign Het
Golga5 A G 12: 102,458,390 (GRCm39) N611S possibly damaging Het
Gucy2c A C 6: 136,721,025 (GRCm39) Y391D probably damaging Het
H6pd A G 4: 150,066,130 (GRCm39) I760T probably damaging Het
Hapln2 T A 3: 87,931,712 (GRCm39) I5F possibly damaging Het
Hdac11 G T 6: 91,145,806 (GRCm39) V169L probably benign Het
Hectd2 T C 19: 36,586,816 (GRCm39) V557A possibly damaging Het
Huwe1 T A X: 150,647,749 (GRCm39) N747K probably benign Het
Ints1 A G 5: 139,760,277 (GRCm39) S66P probably benign Het
Ipo7 A G 7: 109,626,339 (GRCm39) D49G probably damaging Het
Itgb4 G A 11: 115,879,346 (GRCm39) C575Y probably damaging Het
Klhl3 A G 13: 58,181,044 (GRCm39) V250A possibly damaging Het
Klk1b24 A G 7: 43,839,852 (GRCm39) probably null Het
Map3k11 T A 19: 5,745,600 (GRCm39) Y333* probably null Het
Mbp A G 18: 82,572,474 (GRCm39) T57A probably benign Het
Myh9 A G 15: 77,657,464 (GRCm39) probably benign Het
Mypn C T 10: 62,961,472 (GRCm39) R1040Q probably damaging Het
Ncdn A G 4: 126,645,732 (GRCm39) probably null Het
Ndn C T 7: 61,998,256 (GRCm39) P34L probably benign Het
Or10ab5 T A 7: 108,245,571 (GRCm39) T71S probably benign Het
Or11h4 AGGGATTGGG AGGGATTGGGATTGGG 14: 50,974,144 (GRCm39) probably benign Het
Or4k15c A G 14: 50,321,499 (GRCm39) F213S probably benign Het
Or51b6b T C 7: 103,310,005 (GRCm39) probably null Het
Or51f1 G A 7: 102,505,569 (GRCm39) Q307* probably null Het
Or8d2 T A 9: 38,759,901 (GRCm39) S164T possibly damaging Het
Pbx3 T C 2: 34,114,464 (GRCm39) T82A possibly damaging Het
Pi15 T C 1: 17,672,945 (GRCm39) F48S probably benign Het
Pkhd1 A G 1: 20,655,376 (GRCm39) probably benign Het
Ppard C G 17: 28,505,348 (GRCm39) R12G unknown Het
Prrc2c G T 1: 162,532,551 (GRCm39) probably benign Het
Prune1 A G 3: 95,175,553 (GRCm39) Y41H possibly damaging Het
Rcsd1 T C 1: 165,483,541 (GRCm39) D150G probably damaging Het
Rgs12 A T 5: 35,123,456 (GRCm39) Q413L possibly damaging Het
Rhox2h A G X: 36,850,848 (GRCm39) Y185H probably damaging Het
Rnf17 T A 14: 56,741,464 (GRCm39) C1306* probably null Het
Ros1 T A 10: 51,976,183 (GRCm39) M1499L probably benign Het
Rubcnl T C 14: 75,284,989 (GRCm39) S503P probably damaging Het
Sap18b A T 8: 96,552,342 (GRCm39) R117S probably benign Het
Shank2 A G 7: 143,964,336 (GRCm39) E858G probably damaging Het
Shtn1 T C 19: 59,020,632 (GRCm39) R197G probably damaging Het
Slamf8 G A 1: 172,412,087 (GRCm39) R163* probably null Het
Slc6a3 T C 13: 73,714,411 (GRCm39) I392T possibly damaging Het
Sp140 C T 1: 85,547,772 (GRCm39) probably benign Het
Sp8 T C 12: 118,812,751 (GRCm39) V202A possibly damaging Het
Spata13 T C 14: 60,946,908 (GRCm39) V652A probably damaging Het
Stpg2 A T 3: 139,023,162 (GRCm39) T393S probably benign Het
Tagap T C 17: 8,150,299 (GRCm39) M228T probably damaging Het
Tagap A G 17: 8,152,377 (GRCm39) T521A probably benign Het
Tas2r123 T G 6: 132,824,528 (GRCm39) S142A probably damaging Het
Tat T A 8: 110,718,261 (GRCm39) S49T probably benign Het
Tfap4 G T 16: 4,369,933 (GRCm39) Q41K possibly damaging Het
Thbs2 T C 17: 14,906,075 (GRCm39) N275S probably benign Het
Tnfsf14 T A 17: 57,497,867 (GRCm39) R122W probably damaging Het
Tnrc6a T C 7: 122,792,140 (GRCm39) V1886A possibly damaging Het
Trim56 G A 5: 137,143,252 (GRCm39) A88V probably damaging Het
Trio A G 15: 27,841,842 (GRCm39) Y1081H probably damaging Het
Tspear T A 10: 77,706,253 (GRCm39) L341H possibly damaging Het
Ube2o G A 11: 116,432,320 (GRCm39) T882I probably benign Het
Upk3a A G 15: 84,904,815 (GRCm39) T188A possibly damaging Het
Vmn1r79 A C 7: 11,910,358 (GRCm39) D80A probably damaging Het
Wls C A 3: 159,617,450 (GRCm39) T375K probably benign Het
Wnt5a T C 14: 28,233,835 (GRCm39) M1T probably null Het
Zcchc4 A G 5: 52,953,932 (GRCm39) E204G probably damaging Het
Zfp513 G A 5: 31,357,678 (GRCm39) P232S possibly damaging Het
Other mutations in Ap3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Ap3b1 APN 13 94,527,371 (GRCm39) missense probably damaging 1.00
IGL00766:Ap3b1 APN 13 94,679,392 (GRCm39) splice site probably benign
IGL01784:Ap3b1 APN 13 94,630,247 (GRCm39) missense probably damaging 1.00
IGL01979:Ap3b1 APN 13 94,584,971 (GRCm39) nonsense probably null
IGL02040:Ap3b1 APN 13 94,545,353 (GRCm39) critical splice donor site probably null
IGL02119:Ap3b1 APN 13 94,598,911 (GRCm39) missense probably benign 0.01
IGL02247:Ap3b1 APN 13 94,531,303 (GRCm39) critical splice donor site probably null
IGL02303:Ap3b1 APN 13 94,664,827 (GRCm39) missense unknown
IGL02493:Ap3b1 APN 13 94,540,528 (GRCm39) missense probably damaging 0.98
IGL02551:Ap3b1 APN 13 94,554,599 (GRCm39) missense probably damaging 0.99
IGL02651:Ap3b1 APN 13 94,613,529 (GRCm39) missense probably damaging 1.00
IGL02832:Ap3b1 APN 13 94,664,835 (GRCm39) missense unknown
IGL03033:Ap3b1 APN 13 94,585,003 (GRCm39) missense probably benign 0.15
IGL03101:Ap3b1 APN 13 94,591,906 (GRCm39) missense probably benign 0.00
bella UTSW 13 94,664,765 (GRCm39) missense unknown
bullet_gray UTSW 13 94,587,594 (GRCm39) critical splice donor site probably benign
cuttlefish UTSW 13 94,584,959 (GRCm39) critical splice acceptor site probably null
Gastropod UTSW 13 94,679,348 (GRCm39) missense unknown
razor UTSW 13 94,630,239 (GRCm39) missense unknown
Slime UTSW 13 94,540,586 (GRCm39) missense possibly damaging 0.51
slug UTSW 13 94,545,353 (GRCm39) critical splice donor site probably null
snail UTSW 13 94,616,393 (GRCm39) splice site probably benign
stalk UTSW 13 94,609,439 (GRCm39) critical splice donor site probably null
R0034:Ap3b1 UTSW 13 94,616,393 (GRCm39) splice site probably benign
R0265:Ap3b1 UTSW 13 94,630,189 (GRCm39) missense unknown
R0270:Ap3b1 UTSW 13 94,540,626 (GRCm39) splice site probably benign
R0346:Ap3b1 UTSW 13 94,582,479 (GRCm39) nonsense probably null
R0422:Ap3b1 UTSW 13 94,598,968 (GRCm39) missense probably damaging 0.99
R0496:Ap3b1 UTSW 13 94,609,446 (GRCm39) splice site probably benign
R0508:Ap3b1 UTSW 13 94,702,222 (GRCm39) missense unknown
R0764:Ap3b1 UTSW 13 94,616,387 (GRCm39) splice site probably benign
R1506:Ap3b1 UTSW 13 94,582,651 (GRCm39) splice site probably benign
R1593:Ap3b1 UTSW 13 94,638,435 (GRCm39) missense unknown
R1660:Ap3b1 UTSW 13 94,545,320 (GRCm39) missense probably damaging 0.98
R1735:Ap3b1 UTSW 13 94,630,225 (GRCm39) missense unknown
R1818:Ap3b1 UTSW 13 94,608,212 (GRCm39) missense possibly damaging 0.48
R2280:Ap3b1 UTSW 13 94,664,724 (GRCm39) missense unknown
R3031:Ap3b1 UTSW 13 94,702,151 (GRCm39) missense unknown
R3037:Ap3b1 UTSW 13 94,582,486 (GRCm39) critical splice donor site probably null
R4401:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4402:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4403:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4532:Ap3b1 UTSW 13 94,702,243 (GRCm39) missense unknown
R4624:Ap3b1 UTSW 13 94,619,734 (GRCm39) missense unknown
R4626:Ap3b1 UTSW 13 94,540,586 (GRCm39) missense possibly damaging 0.51
R4754:Ap3b1 UTSW 13 94,540,468 (GRCm39) missense probably damaging 1.00
R4788:Ap3b1 UTSW 13 94,702,149 (GRCm39) missense unknown
R4847:Ap3b1 UTSW 13 94,608,287 (GRCm39) missense probably benign 0.15
R4886:Ap3b1 UTSW 13 94,609,313 (GRCm39) missense possibly damaging 0.50
R5096:Ap3b1 UTSW 13 94,616,357 (GRCm39) missense unknown
R5628:Ap3b1 UTSW 13 94,613,556 (GRCm39) missense unknown
R5671:Ap3b1 UTSW 13 94,664,765 (GRCm39) missense unknown
R5677:Ap3b1 UTSW 13 94,664,704 (GRCm39) missense unknown
R5862:Ap3b1 UTSW 13 94,684,278 (GRCm39) missense unknown
R5941:Ap3b1 UTSW 13 94,619,773 (GRCm39) missense probably damaging 0.96
R5941:Ap3b1 UTSW 13 94,576,781 (GRCm39) missense probably benign 0.02
R6043:Ap3b1 UTSW 13 94,613,501 (GRCm39) missense probably benign 0.09
R6212:Ap3b1 UTSW 13 94,630,207 (GRCm39) missense unknown
R6212:Ap3b1 UTSW 13 94,587,581 (GRCm39) missense probably damaging 1.00
R6301:Ap3b1 UTSW 13 94,664,803 (GRCm39) missense unknown
R6765:Ap3b1 UTSW 13 94,599,017 (GRCm39) missense probably benign 0.02
R6812:Ap3b1 UTSW 13 94,616,369 (GRCm39) missense unknown
R6888:Ap3b1 UTSW 13 94,545,299 (GRCm39) missense probably benign 0.42
R6901:Ap3b1 UTSW 13 94,554,650 (GRCm39) missense probably benign 0.00
R7157:Ap3b1 UTSW 13 94,668,542 (GRCm39) nonsense probably null
R7422:Ap3b1 UTSW 13 94,664,673 (GRCm39) missense unknown
R7642:Ap3b1 UTSW 13 94,613,540 (GRCm39) missense probably benign 0.19
R7710:Ap3b1 UTSW 13 94,587,581 (GRCm39) missense probably damaging 1.00
R7757:Ap3b1 UTSW 13 94,664,666 (GRCm39) splice site probably null
R7867:Ap3b1 UTSW 13 94,619,771 (GRCm39) missense unknown
R8492:Ap3b1 UTSW 13 94,531,294 (GRCm39) missense possibly damaging 0.60
R8706:Ap3b1 UTSW 13 94,545,353 (GRCm39) critical splice donor site probably null
R8749:Ap3b1 UTSW 13 94,664,725 (GRCm39) missense unknown
R8876:Ap3b1 UTSW 13 94,540,586 (GRCm39) missense possibly damaging 0.51
R8889:Ap3b1 UTSW 13 94,679,348 (GRCm39) missense unknown
R8892:Ap3b1 UTSW 13 94,679,348 (GRCm39) missense unknown
R9065:Ap3b1 UTSW 13 94,608,223 (GRCm39) missense probably damaging 1.00
R9152:Ap3b1 UTSW 13 94,630,239 (GRCm39) missense unknown
R9152:Ap3b1 UTSW 13 94,609,439 (GRCm39) critical splice donor site probably null
R9166:Ap3b1 UTSW 13 94,608,236 (GRCm39) missense probably damaging 1.00
R9218:Ap3b1 UTSW 13 94,584,959 (GRCm39) critical splice acceptor site probably null
R9269:Ap3b1 UTSW 13 94,540,570 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTCCTTAACGTTCTCTGGC -3'
(R):5'- CTTAATACTTTAGACATGAGCTTCACT -3'

Sequencing Primer
(F):5'- CTGACATGTGGTTTAGCTAAGGTAAC -3'
(R):5'- TGAGCTTCACTAATAATTACACCAC -3'
Posted On 2014-06-23