Mutagenetix > Incidental Mutation

Incidental Mutation 'R1791:Ap3b1'

201765

Institutional Source

Beutler Lab

Gene Symbol

Ap3b1

Ensembl Gene

ENSMUSG00000021686

Gene Name

adaptor-related protein complex 3, beta 1 subunit

Synonyms

recombination induced mutation 2, rim2, Hps2, beta3A, AP-3

MMRRC Submission

039821-MU

Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;

Essential gene?

Possibly non essential (E-score: 0.441) question?

Stock #

R1791 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

94358960-94566317 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 94408797 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 186 (E186G)

Ref Sequence

ENSEMBL: ENSMUSP00000022196 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022196]

AlphaFold

Q9Z1T1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022196
AA Change: E186G

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: E186G

Domain	Start	End	E-Value	Type
low complexity region	10	24	N/A	INTRINSIC
Pfam:Adaptin_N	39	586	1.2e-170	PFAM
Pfam:SEEEED	672	812	1.3e-27	PFAM
AP3B1_C	822	969	1.58e-78	SMART
Blast:B2	993	1103	2e-27	BLAST

Meta Mutation Damage Score

0.2475

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.6%

Validation Efficiency

95% (104/110)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]

Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	C	A	6: 121,654,612	L623M	probably benign	Het
Akap13	T	G	7: 75,611,035	C333G	probably benign	Het
Akap6	T	C	12: 53,069,125	S1004P	probably damaging	Het
Akap7	T	C	10: 25,239,685	T181A	probably benign	Het
Arhgap17	T	C	7: 123,286,702	T736A	probably benign	Het
Bmp8a	G	T	4: 123,324,585	R214S	possibly damaging	Het
Cacna1f	T	C	X: 7,620,439	S890P	probably damaging	Het
Cd96	A	T	16: 46,117,999	Y34*	probably null	Het
Cdc42ep4	A	G	11: 113,729,337	L76P	probably damaging	Het
Cdh23	A	G	10: 60,391,726	V1195A	possibly damaging	Het
Cfap57	G	A	4: 118,571,724	T1015M	possibly damaging	Het
Chrm3	C	A	13: 9,877,416	G528V	probably damaging	Het
Clip4	T	C	17: 71,801,942		probably benign	Het
Col9a1	A	T	1: 24,185,305	R189S	unknown	Het
Cul4b	A	T	X: 38,547,851	I481N	probably damaging	Het
Cyp26b1	A	G	6: 84,584,459	S74P	probably benign	Het
Cyp3a57	A	G	5: 145,371,010	N192S	probably benign	Het
Dcbld1	A	G	10: 52,319,476	D260G	probably damaging	Het
Dhrs7	T	C	12: 72,653,165	N231S	probably benign	Het
Disp3	G	A	4: 148,241,518	P1261L	probably damaging	Het
Dyx1c1	T	C	9: 72,960,684	Y76H	possibly damaging	Het
Eml5	C	A	12: 98,887,056	V95F	probably benign	Het
Emsy	A	G	7: 98,647,880	I32T	probably damaging	Het
Esr1	A	G	10: 4,783,913	R238G	probably damaging	Het
Exosc1	T	C	19: 41,928,085	K84R	probably benign	Het
F830016B08Rik	T	A	18: 60,300,517	V224E	probably benign	Het
Fam228a	T	A	12: 4,732,748	N115I	probably damaging	Het
Farp1	T	C	14: 121,256,745	I546T	probably damaging	Het
Fbxo30	T	A	10: 11,289,787	C84*	probably null	Het
Fbxw17	A	G	13: 50,425,774		probably benign	Het
Foxo4	G	C	X: 101,258,463	R192P	probably benign	Het
Galnt7	G	T	8: 57,542,530	T377K	probably benign	Het
Garnl3	T	C	2: 33,034,127	I248V	probably benign	Het
Glod4	A	G	11: 76,237,708	Y104H	probably damaging	Het
Glrb	T	C	3: 80,860,175	Y246C	probably damaging	Het
Gm5292	A	G	5: 43,944,410		noncoding transcript	Het
Gm5424	C	A	10: 62,072,307		noncoding transcript	Het
Gm7276	C	T	18: 77,185,735		probably benign	Het
Gm9774	T	A	3: 92,428,231	D388V	probably damaging	Het
Golga5	A	G	12: 102,492,131	N611S	possibly damaging	Het
Gucy2c	A	C	6: 136,744,027	Y391D	probably damaging	Het
H6pd	A	G	4: 149,981,673	I760T	probably damaging	Het
Hapln2	T	A	3: 88,024,405	I5F	possibly damaging	Het
Hdac11	G	T	6: 91,168,824	V169L	probably benign	Het
Hectd2	T	C	19: 36,609,416	V557A	possibly damaging	Het
Huwe1	T	A	X: 151,864,753	N747K	probably benign	Het
Ints1	A	G	5: 139,774,522	S66P	probably benign	Het
Ipo7	A	G	7: 110,027,132	D49G	probably damaging	Het
Itgb4	G	A	11: 115,988,520	C575Y	probably damaging	Het
Klhl3	A	G	13: 58,033,230	V250A	possibly damaging	Het
Klk1b24	A	G	7: 44,190,428		probably null	Het
Map3k11	T	A	19: 5,695,572	Y333*	probably null	Het
Mbp	A	G	18: 82,554,349	T57A	probably benign	Het
Myh9	A	G	15: 77,773,264		probably benign	Het
Mypn	C	T	10: 63,125,693	R1040Q	probably damaging	Het
Ncdn	A	G	4: 126,751,939		probably null	Het
Ndn	C	T	7: 62,348,508	P34L	probably benign	Het
Odf3l1	A	T	9: 56,851,743	F43I	possibly damaging	Het
Olfr509	T	A	7: 108,646,364	T71S	probably benign	Het
Olfr566	G	A	7: 102,856,362	Q307*	probably null	Het
Olfr623	T	C	7: 103,660,798		probably null	Het
Olfr726	A	G	14: 50,084,042	F213S	probably benign	Het
Olfr749	AGGGATTGGG	AGGGATTGGGATTGGG	14: 50,736,687		probably benign	Het
Olfr924	T	A	9: 38,848,605	S164T	possibly damaging	Het
Pbx3	T	C	2: 34,224,452	T82A	possibly damaging	Het
Pi15	T	C	1: 17,602,721	F48S	probably benign	Het
Pkhd1	A	G	1: 20,585,152		probably benign	Het
Ppard	C	G	17: 28,286,374	R12G	unknown	Het
Prrc2c	G	T	1: 162,704,982		probably benign	Het
Prune1	A	G	3: 95,268,242	Y41H	possibly damaging	Het
Rcsd1	T	C	1: 165,655,972	D150G	probably damaging	Het
Rgs12	A	T	5: 34,966,112	Q413L	possibly damaging	Het
Rhox2h	A	G	X: 37,669,195	Y185H	probably damaging	Het
Rnf17	T	A	14: 56,504,007	C1306*	probably null	Het
Ros1	T	A	10: 52,100,087	M1499L	probably benign	Het
Rubcnl	T	C	14: 75,047,549	S503P	probably damaging	Het
Sap18b	A	T	8: 95,825,714	R117S	probably benign	Het
Shank2	A	G	7: 144,410,599	E858G	probably damaging	Het
Shtn1	T	C	19: 59,032,200	R197G	probably damaging	Het
Slamf8	G	A	1: 172,584,520	R163*	probably null	Het
Slc6a3	T	C	13: 73,566,292	I392T	possibly damaging	Het
Sp140	C	T	1: 85,620,051		probably benign	Het
Sp8	T	C	12: 118,849,016	V202A	possibly damaging	Het
Spata13	T	C	14: 60,709,459	V652A	probably damaging	Het
Stpg2	A	T	3: 139,317,401	T393S	probably benign	Het
Tagap	T	C	17: 7,931,467	M228T	probably damaging	Het
Tagap	A	G	17: 7,933,545	T521A	probably benign	Het
Tas2r123	T	G	6: 132,847,565	S142A	probably damaging	Het
Tat	T	A	8: 109,991,629	S49T	probably benign	Het
Tfap4	G	T	16: 4,552,069	Q41K	possibly damaging	Het
Thbs2	T	C	17: 14,685,813	N275S	probably benign	Het
Tnfsf14	T	A	17: 57,190,867	R122W	probably damaging	Het
Tnrc6a	T	C	7: 123,192,917	V1886A	possibly damaging	Het
Trim56	G	A	5: 137,114,398	A88V	probably damaging	Het
Trio	A	G	15: 27,841,756	Y1081H	probably damaging	Het
Tspear	T	A	10: 77,870,419	L341H	possibly damaging	Het
Ube2o	G	A	11: 116,541,494	T882I	probably benign	Het
Uhrf1bp1	T	A	17: 27,894,746	D1297E	probably damaging	Het
Upk3a	A	G	15: 85,020,614	T188A	possibly damaging	Het
Vmn1r79	A	C	7: 12,176,431	D80A	probably damaging	Het
Wls	C	A	3: 159,911,813	T375K	probably benign	Het
Wnt5a	T	C	14: 28,511,878	M1T	probably null	Het
Zcchc4	A	G	5: 52,796,590	E204G	probably damaging	Het
Zfp513	G	A	5: 31,200,334	P232S	possibly damaging	Het

Other mutations in Ap3b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00660:Ap3b1	APN	13	94390863	missense	probably damaging	1.00
IGL00766:Ap3b1	APN	13	94542884	splice site	probably benign
IGL01784:Ap3b1	APN	13	94493739	missense	probably damaging	1.00
IGL01979:Ap3b1	APN	13	94448463	nonsense	probably null
IGL02040:Ap3b1	APN	13	94408845	critical splice donor site	probably null
IGL02119:Ap3b1	APN	13	94462403	missense	probably benign	0.01
IGL02247:Ap3b1	APN	13	94394795	critical splice donor site	probably null
IGL02303:Ap3b1	APN	13	94528319	missense	unknown
IGL02493:Ap3b1	APN	13	94404020	missense	probably damaging	0.98
IGL02551:Ap3b1	APN	13	94418091	missense	probably damaging	0.99
IGL02651:Ap3b1	APN	13	94477021	missense	probably damaging	1.00
IGL02832:Ap3b1	APN	13	94528327	missense	unknown
IGL03033:Ap3b1	APN	13	94448495	missense	probably benign	0.15
IGL03101:Ap3b1	APN	13	94455398	missense	probably benign	0.00
bella	UTSW	13	94528257	missense	unknown
bullet_gray	UTSW	13	94451086	critical splice donor site	probably benign
cuttlefish	UTSW	13	94448451	critical splice acceptor site	probably null
Gastropod	UTSW	13	94542840	missense	unknown
razor	UTSW	13	94493731	missense	unknown
Slime	UTSW	13	94404078	missense	possibly damaging	0.51
slug	UTSW	13	94408845	critical splice donor site	probably null
snail	UTSW	13	94479885	splice site	probably benign
stalk	UTSW	13	94472931	critical splice donor site	probably null
R0034:Ap3b1	UTSW	13	94479885	splice site	probably benign
R0265:Ap3b1	UTSW	13	94493681	missense	unknown
R0270:Ap3b1	UTSW	13	94404118	splice site	probably benign
R0346:Ap3b1	UTSW	13	94445971	nonsense	probably null
R0422:Ap3b1	UTSW	13	94462460	missense	probably damaging	0.99
R0496:Ap3b1	UTSW	13	94472938	splice site	probably benign
R0508:Ap3b1	UTSW	13	94565714	missense	unknown
R0764:Ap3b1	UTSW	13	94479879	splice site	probably benign
R1506:Ap3b1	UTSW	13	94446143	splice site	probably benign
R1593:Ap3b1	UTSW	13	94501927	missense	unknown
R1660:Ap3b1	UTSW	13	94408812	missense	probably damaging	0.98
R1735:Ap3b1	UTSW	13	94493717	missense	unknown
R1818:Ap3b1	UTSW	13	94471704	missense	possibly damaging	0.48
R2280:Ap3b1	UTSW	13	94528216	missense	unknown
R3031:Ap3b1	UTSW	13	94565643	missense	unknown
R3037:Ap3b1	UTSW	13	94445978	critical splice donor site	probably null
R4401:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4402:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4403:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4532:Ap3b1	UTSW	13	94565735	missense	unknown
R4624:Ap3b1	UTSW	13	94483226	missense	unknown
R4626:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R4754:Ap3b1	UTSW	13	94403960	missense	probably damaging	1.00
R4788:Ap3b1	UTSW	13	94565641	missense	unknown
R4847:Ap3b1	UTSW	13	94471779	missense	probably benign	0.15
R4886:Ap3b1	UTSW	13	94472805	missense	possibly damaging	0.50
R5096:Ap3b1	UTSW	13	94479849	missense	unknown
R5628:Ap3b1	UTSW	13	94477048	missense	unknown
R5671:Ap3b1	UTSW	13	94528257	missense	unknown
R5677:Ap3b1	UTSW	13	94528196	missense	unknown
R5862:Ap3b1	UTSW	13	94547770	missense	unknown
R5941:Ap3b1	UTSW	13	94440273	missense	probably benign	0.02
R5941:Ap3b1	UTSW	13	94483265	missense	probably damaging	0.96
R6043:Ap3b1	UTSW	13	94476993	missense	probably benign	0.09
R6212:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R6212:Ap3b1	UTSW	13	94493699	missense	unknown
R6301:Ap3b1	UTSW	13	94528295	missense	unknown
R6765:Ap3b1	UTSW	13	94462509	missense	probably benign	0.02
R6812:Ap3b1	UTSW	13	94479861	missense	unknown
R6888:Ap3b1	UTSW	13	94408791	missense	probably benign	0.42
R6901:Ap3b1	UTSW	13	94418142	missense	probably benign	0.00
R7157:Ap3b1	UTSW	13	94532034	nonsense	probably null
R7422:Ap3b1	UTSW	13	94528165	missense	unknown
R7642:Ap3b1	UTSW	13	94477032	missense	probably benign	0.19
R7710:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R7757:Ap3b1	UTSW	13	94528158	splice site	probably null
R7867:Ap3b1	UTSW	13	94483263	missense	unknown
R8492:Ap3b1	UTSW	13	94394786	missense	possibly damaging	0.60
R8706:Ap3b1	UTSW	13	94408845	critical splice donor site	probably null
R8749:Ap3b1	UTSW	13	94528217	missense	unknown
R8876:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R8889:Ap3b1	UTSW	13	94542840	missense	unknown
R8892:Ap3b1	UTSW	13	94542840	missense	unknown
R9065:Ap3b1	UTSW	13	94471715	missense	probably damaging	1.00
R9152:Ap3b1	UTSW	13	94472931	critical splice donor site	probably null
R9152:Ap3b1	UTSW	13	94493731	missense	unknown
R9166:Ap3b1	UTSW	13	94471728	missense	probably damaging	1.00
R9218:Ap3b1	UTSW	13	94448451	critical splice acceptor site	probably null
R9269:Ap3b1	UTSW	13	94404062	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGTCCTTAACGTTCTCTGGC -3'
(R):5'- CTTAATACTTTAGACATGAGCTTCACT -3'

Sequencing Primer
(F):5'- CTGACATGTGGTTTAGCTAAGGTAAC -3'
(R):5'- TGAGCTTCACTAATAATTACACCAC -3'

Posted On

2014-06-23