Incidental Mutation 'R1791:Farp1'
ID201772
Institutional Source Beutler Lab
Gene Symbol Farp1
Ensembl Gene ENSMUSG00000025555
Gene NameFERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived)
SynonymsCdep
MMRRC Submission 039821-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1791 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location121035200-121283744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121256745 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 546 (I546T)
Ref Sequence ENSEMBL: ENSMUSP00000026635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026635]
Predicted Effect probably damaging
Transcript: ENSMUST00000026635
AA Change: I546T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026635
Gene: ENSMUSG00000025555
AA Change: I546T

DomainStartEndE-ValueType
B41 36 230 3.27e-68 SMART
FERM_C 234 324 3.87e-32 SMART
FA 328 374 6.07e-16 SMART
RhoGEF 546 732 2.07e-47 SMART
PH 763 861 1.05e-16 SMART
PH 936 1034 1.55e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137971
Meta Mutation Damage Score 0.5823 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency 95% (104/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a FERM (4.2, exrin, radixin, moesin) domain, a Dbl homology domain, and two pleckstrin homology domains. These domains are found in guanine nucleotide exchange factors and proteins that link the cytoskeleton to the cell membrane. The encoded protein functions in neurons to promote dendritic growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C A 6: 121,654,612 L623M probably benign Het
Akap13 T G 7: 75,611,035 C333G probably benign Het
Akap6 T C 12: 53,069,125 S1004P probably damaging Het
Akap7 T C 10: 25,239,685 T181A probably benign Het
Ap3b1 A G 13: 94,408,797 E186G possibly damaging Het
Arhgap17 T C 7: 123,286,702 T736A probably benign Het
Bmp8a G T 4: 123,324,585 R214S possibly damaging Het
Cacna1f T C X: 7,620,439 S890P probably damaging Het
Cd96 A T 16: 46,117,999 Y34* probably null Het
Cdc42ep4 A G 11: 113,729,337 L76P probably damaging Het
Cdh23 A G 10: 60,391,726 V1195A possibly damaging Het
Cfap57 G A 4: 118,571,724 T1015M possibly damaging Het
Chrm3 C A 13: 9,877,416 G528V probably damaging Het
Clip4 T C 17: 71,801,942 probably benign Het
Col9a1 A T 1: 24,185,305 R189S unknown Het
Cul4b A T X: 38,547,851 I481N probably damaging Het
Cyp26b1 A G 6: 84,584,459 S74P probably benign Het
Cyp3a57 A G 5: 145,371,010 N192S probably benign Het
Dcbld1 A G 10: 52,319,476 D260G probably damaging Het
Dhrs7 T C 12: 72,653,165 N231S probably benign Het
Disp3 G A 4: 148,241,518 P1261L probably damaging Het
Dyx1c1 T C 9: 72,960,684 Y76H possibly damaging Het
Eml5 C A 12: 98,887,056 V95F probably benign Het
Emsy A G 7: 98,647,880 I32T probably damaging Het
Esr1 A G 10: 4,783,913 R238G probably damaging Het
Exosc1 T C 19: 41,928,085 K84R probably benign Het
F830016B08Rik T A 18: 60,300,517 V224E probably benign Het
Fam228a T A 12: 4,732,748 N115I probably damaging Het
Fbxo30 T A 10: 11,289,787 C84* probably null Het
Fbxw17 A G 13: 50,425,774 probably benign Het
Foxo4 G C X: 101,258,463 R192P probably benign Het
Galnt7 G T 8: 57,542,530 T377K probably benign Het
Garnl3 T C 2: 33,034,127 I248V probably benign Het
Glod4 A G 11: 76,237,708 Y104H probably damaging Het
Glrb T C 3: 80,860,175 Y246C probably damaging Het
Gm5292 A G 5: 43,944,410 noncoding transcript Het
Gm5424 C A 10: 62,072,307 noncoding transcript Het
Gm7276 C T 18: 77,185,735 probably benign Het
Gm9774 T A 3: 92,428,231 D388V probably damaging Het
Golga5 A G 12: 102,492,131 N611S possibly damaging Het
Gucy2c A C 6: 136,744,027 Y391D probably damaging Het
H6pd A G 4: 149,981,673 I760T probably damaging Het
Hapln2 T A 3: 88,024,405 I5F possibly damaging Het
Hdac11 G T 6: 91,168,824 V169L probably benign Het
Hectd2 T C 19: 36,609,416 V557A possibly damaging Het
Huwe1 T A X: 151,864,753 N747K probably benign Het
Ints1 A G 5: 139,774,522 S66P probably benign Het
Ipo7 A G 7: 110,027,132 D49G probably damaging Het
Itgb4 G A 11: 115,988,520 C575Y probably damaging Het
Klhl3 A G 13: 58,033,230 V250A possibly damaging Het
Klk1b24 A G 7: 44,190,428 probably null Het
Map3k11 T A 19: 5,695,572 Y333* probably null Het
Mbp A G 18: 82,554,349 T57A probably benign Het
Myh9 A G 15: 77,773,264 probably benign Het
Mypn C T 10: 63,125,693 R1040Q probably damaging Het
Ncdn A G 4: 126,751,939 probably null Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Odf3l1 A T 9: 56,851,743 F43I possibly damaging Het
Olfr509 T A 7: 108,646,364 T71S probably benign Het
Olfr566 G A 7: 102,856,362 Q307* probably null Het
Olfr623 T C 7: 103,660,798 probably null Het
Olfr726 A G 14: 50,084,042 F213S probably benign Het
Olfr749 AGGGATTGGG AGGGATTGGGATTGGG 14: 50,736,687 probably benign Het
Olfr924 T A 9: 38,848,605 S164T possibly damaging Het
Pbx3 T C 2: 34,224,452 T82A possibly damaging Het
Pi15 T C 1: 17,602,721 F48S probably benign Het
Pkhd1 A G 1: 20,585,152 probably benign Het
Ppard C G 17: 28,286,374 R12G unknown Het
Prrc2c G T 1: 162,704,982 probably benign Het
Prune1 A G 3: 95,268,242 Y41H possibly damaging Het
Rcsd1 T C 1: 165,655,972 D150G probably damaging Het
Rgs12 A T 5: 34,966,112 Q413L possibly damaging Het
Rhox2h A G X: 37,669,195 Y185H probably damaging Het
Rnf17 T A 14: 56,504,007 C1306* probably null Het
Ros1 T A 10: 52,100,087 M1499L probably benign Het
Rubcnl T C 14: 75,047,549 S503P probably damaging Het
Sap18b A T 8: 95,825,714 R117S probably benign Het
Shank2 A G 7: 144,410,599 E858G probably damaging Het
Shtn1 T C 19: 59,032,200 R197G probably damaging Het
Slamf8 G A 1: 172,584,520 R163* probably null Het
Slc6a3 T C 13: 73,566,292 I392T possibly damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Sp8 T C 12: 118,849,016 V202A possibly damaging Het
Spata13 T C 14: 60,709,459 V652A probably damaging Het
Stpg2 A T 3: 139,317,401 T393S probably benign Het
Tagap T C 17: 7,931,467 M228T probably damaging Het
Tagap A G 17: 7,933,545 T521A probably benign Het
Tas2r123 T G 6: 132,847,565 S142A probably damaging Het
Tat T A 8: 109,991,629 S49T probably benign Het
Tfap4 G T 16: 4,552,069 Q41K possibly damaging Het
Thbs2 T C 17: 14,685,813 N275S probably benign Het
Tnfsf14 T A 17: 57,190,867 R122W probably damaging Het
Tnrc6a T C 7: 123,192,917 V1886A possibly damaging Het
Trim56 G A 5: 137,114,398 A88V probably damaging Het
Trio A G 15: 27,841,756 Y1081H probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Ube2o G A 11: 116,541,494 T882I probably benign Het
Uhrf1bp1 T A 17: 27,894,746 D1297E probably damaging Het
Upk3a A G 15: 85,020,614 T188A possibly damaging Het
Vmn1r79 A C 7: 12,176,431 D80A probably damaging Het
Wls C A 3: 159,911,813 T375K probably benign Het
Wnt5a T C 14: 28,511,878 M1T probably null Het
Zcchc4 A G 5: 52,796,590 E204G probably damaging Het
Zfp513 G A 5: 31,200,334 P232S possibly damaging Het
Other mutations in Farp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Farp1 APN 14 121237149 missense probably damaging 1.00
IGL01017:Farp1 APN 14 121272774 missense possibly damaging 0.64
IGL02309:Farp1 APN 14 121243516 missense probably benign
IGL02376:Farp1 APN 14 121272856 missense probably damaging 0.98
IGL03018:Farp1 APN 14 121102169 missense probably benign
IGL03400:Farp1 APN 14 121207321 missense probably damaging 1.00
R0034:Farp1 UTSW 14 121255429 missense probably benign 0.00
R0046:Farp1 UTSW 14 121255513 missense probably benign 0.00
R0046:Farp1 UTSW 14 121255513 missense probably benign 0.00
R0219:Farp1 UTSW 14 121243600 missense possibly damaging 0.88
R0359:Farp1 UTSW 14 121255396 splice site probably benign
R0616:Farp1 UTSW 14 121277022 missense probably damaging 1.00
R0653:Farp1 UTSW 14 121233846 critical splice donor site probably null
R0710:Farp1 UTSW 14 121237143 missense probably damaging 1.00
R1391:Farp1 UTSW 14 121257966 nonsense probably null
R1920:Farp1 UTSW 14 121255496 missense probably benign 0.16
R1953:Farp1 UTSW 14 121255482 missense probably benign
R1958:Farp1 UTSW 14 121219375 critical splice acceptor site probably null
R2891:Farp1 UTSW 14 121256736 missense probably damaging 1.00
R3121:Farp1 UTSW 14 121222726 splice site probably benign
R4005:Farp1 UTSW 14 121276397 missense probably damaging 0.99
R4257:Farp1 UTSW 14 121255479 missense probably benign 0.00
R4559:Farp1 UTSW 14 121272801 missense probably damaging 1.00
R4654:Farp1 UTSW 14 121276304 missense possibly damaging 0.50
R4739:Farp1 UTSW 14 121238787 missense probably damaging 1.00
R4831:Farp1 UTSW 14 121277057 missense probably damaging 1.00
R4988:Farp1 UTSW 14 121275607 missense probably damaging 1.00
R5379:Farp1 UTSW 14 121256757 missense possibly damaging 0.88
R5463:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5466:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5467:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5511:Farp1 UTSW 14 121237172 missense probably damaging 0.98
R5520:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5635:Farp1 UTSW 14 121276304 missense possibly damaging 0.96
R5639:Farp1 UTSW 14 121275382 missense probably damaging 1.00
R5954:Farp1 UTSW 14 121222667 missense probably damaging 0.99
R6765:Farp1 UTSW 14 121222654 missense probably benign 0.00
R7469:Farp1 UTSW 14 121275421 missense probably damaging 1.00
R7549:Farp1 UTSW 14 121235177 missense possibly damaging 0.89
R7660:Farp1 UTSW 14 121276922 missense probably benign 0.00
R7752:Farp1 UTSW 14 121257947 missense probably damaging 1.00
R7788:Farp1 UTSW 14 121276253 missense probably benign 0.12
R7911:Farp1 UTSW 14 121242406 missense probably damaging 1.00
R8013:Farp1 UTSW 14 121242401 missense probably damaging 1.00
R8078:Farp1 UTSW 14 121276300 missense probably benign 0.04
R8113:Farp1 UTSW 14 121275596 missense probably benign 0.35
R8116:Farp1 UTSW 14 121233820 missense probably damaging 1.00
R8716:Farp1 UTSW 14 121242443 missense probably benign
RF024:Farp1 UTSW 14 121237148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAGGAAATAGGCTTCTTTAGAC -3'
(R):5'- GTTGACTGCCATAACCCAGG -3'

Sequencing Primer
(F):5'- AGGCTTCTTTAGACTTGATAGTAGC -3'
(R):5'- CCATAACCCAGGGTCAGGATG -3'
Posted On2014-06-23