Incidental Mutation 'R1792:Fmo4'
ID201799
Institutional Source Beutler Lab
Gene Symbol Fmo4
Ensembl Gene ENSMUSG00000026692
Gene Nameflavin containing monooxygenase 4
Synonyms
MMRRC Submission 039822-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R1792 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location162793188-162813972 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 162794290 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 451 (I451F)
Ref Sequence ENSEMBL: ENSMUSP00000107150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028014] [ENSMUST00000111525]
Predicted Effect probably benign
Transcript: ENSMUST00000028014
AA Change: I451F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028014
Gene: ENSMUSG00000026692
AA Change: I451F

DomainStartEndE-ValueType
Pfam:FMO-like 2 531 9.4e-272 PFAM
Pfam:Pyr_redox_2 4 430 1e-8 PFAM
Pfam:Pyr_redox_3 6 220 5.1e-16 PFAM
Pfam:K_oxygenase 68 227 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111525
AA Change: I451F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107150
Gene: ENSMUSG00000026692
AA Change: I451F

DomainStartEndE-ValueType
Pfam:FMO-like 2 531 9.4e-272 PFAM
Pfam:Pyr_redox_2 3 225 1.7e-11 PFAM
Pfam:Pyr_redox_3 6 220 2.5e-9 PFAM
Pfam:K_oxygenase 67 227 6e-12 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metabolic N-oxidation of diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man. This results in a small subpopulation with reduced TMA N-oxidation capacity and causes fish odor syndrome (Trimethylaminuria). Three forms of the enzyme are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 C T 11: 110,184,044 V1398I probably benign Het
Ackr3 A T 1: 90,214,898 N360Y probably benign Het
Acr T G 15: 89,573,143 M198R probably benign Het
Adamts14 A T 10: 61,218,498 M585K probably benign Het
Adgrb3 A T 1: 25,228,471 C853S probably damaging Het
Arhgef28 G T 13: 97,931,186 S1410R probably benign Het
Armc4 T C 18: 7,286,743 T163A probably benign Het
Asprv1 T A 6: 86,628,372 F67I possibly damaging Het
Atp8b4 T A 2: 126,325,294 Y1095F probably benign Het
Cadps A G 14: 12,449,802 S1136P possibly damaging Het
Ccdc36 A C 9: 108,404,912 S526A possibly damaging Het
Ccdc57 T C 11: 120,897,881 Q380R possibly damaging Het
Cdc45 A T 16: 18,807,340 D142E probably benign Het
Cs A T 10: 128,360,079 N386Y possibly damaging Het
Dsc3 A T 18: 19,986,998 V201E probably damaging Het
Dusp26 G T 8: 31,091,935 R19L probably benign Het
Esyt3 C A 9: 99,358,116 E92* probably null Het
Ext2 T C 2: 93,704,545 N625D probably damaging Het
Fam208b T C 13: 3,590,559 K193E possibly damaging Het
Flvcr2 A T 12: 85,747,155 K102* probably null Het
Fmnl2 T A 2: 53,042,317 S103T possibly damaging Het
Gak A T 5: 108,585,531 Y47* probably null Het
Gbp10 A T 5: 105,224,300 L198Q probably damaging Het
Gm11559 T A 11: 99,864,929 S135T unknown Het
Gm14496 A T 2: 181,996,153 D340V probably benign Het
Grin2a T C 16: 9,992,395 T47A possibly damaging Het
Gtf2ird1 A T 5: 134,366,936 probably null Het
Herc4 T A 10: 63,245,901 M1K probably null Het
Hirip3 T A 7: 126,862,620 V29E probably damaging Het
Hs3st5 A G 10: 36,832,724 D85G probably benign Het
Htt T A 5: 34,907,199 S2981T probably damaging Het
Il20ra G A 10: 19,759,636 V542I probably damaging Het
Itgb2l C A 16: 96,425,082 C603F probably damaging Het
Klhl41 A C 2: 69,670,802 K202N probably benign Het
Lct G A 1: 128,327,942 S121F possibly damaging Het
Lhx6 C T 2: 36,087,375 G355D probably damaging Het
Limk2 A G 11: 3,358,236 V121A probably benign Het
Med1 T G 11: 98,157,283 K896Q probably damaging Het
Muc6 A G 7: 141,634,458 F2789S probably benign Het
Nemf T A 12: 69,312,569 Y997F probably damaging Het
Nrap A G 19: 56,379,158 S296P probably benign Het
Nrxn1 T C 17: 90,588,824 N961D probably damaging Het
Olfr220 T C 1: 174,448,737 V38A probably benign Het
Olfr398 A C 11: 73,983,847 S254A probably benign Het
Olfr777 A T 10: 129,269,243 F27I probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdk4 T A 6: 5,489,166 H247L probably damaging Het
Pkd1l3 T A 8: 109,632,605 V866E probably damaging Het
Pla2g4e G A 2: 120,168,474 P803L probably damaging Het
Pnisr T C 4: 21,860,968 V217A possibly damaging Het
Pole4 G A 6: 82,652,739 P34L unknown Het
Pole4 G T 6: 82,652,740 P34T unknown Het
Ptchd3 G A 11: 121,841,551 W422* probably null Het
Rab1b C T 19: 5,100,485 A167T probably benign Het
Rasal1 T C 5: 120,664,756 M359T probably benign Het
Rexo4 T C 2: 26,960,236 N310D probably benign Het
Rgma C T 7: 73,417,837 T280M probably damaging Het
Rnaset2a A T 17: 8,145,576 I43N probably damaging Het
Rtcb A T 10: 85,942,582 V399E probably damaging Het
Scd4 T G 19: 44,337,574 Y122* probably null Het
Sirt6 T C 10: 81,626,521 I15V possibly damaging Het
Slamf8 A T 1: 172,587,959 V104E possibly damaging Het
Slc12a4 A G 8: 105,951,843 I285T possibly damaging Het
Slc25a13 G A 6: 6,115,104 A207V possibly damaging Het
Slc6a21 T C 7: 45,280,731 S185P probably benign Het
Smarcc2 A C 10: 128,463,871 N135T probably damaging Het
Susd6 T C 12: 80,874,291 S221P probably damaging Het
Syne1 C T 10: 5,040,975 G8418D probably damaging Het
Tbc1d7 C T 13: 43,165,377 V95I probably benign Het
Tcerg1l T C 7: 138,361,866 D225G probably benign Het
Tfip11 A T 5: 112,329,397 I82F possibly damaging Het
Tmem41a C T 16: 21,936,981 G192S probably null Het
Trrap G A 5: 144,853,586 A3619T possibly damaging Het
Tspoap1 G A 11: 87,765,881 probably null Het
Wfdc21 T C 11: 83,747,057 S11P probably benign Het
Zc2hc1b A T 10: 13,168,730 V63E probably damaging Het
Other mutations in Fmo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Fmo4 APN 1 162794023 missense probably benign 0.00
IGL01090:Fmo4 APN 1 162809785 splice site probably null
IGL01295:Fmo4 APN 1 162799124 missense probably damaging 1.00
IGL02089:Fmo4 APN 1 162799080 missense probably benign 0.04
IGL02483:Fmo4 APN 1 162808421 missense possibly damaging 0.60
R0608:Fmo4 UTSW 1 162803651 missense possibly damaging 0.95
R0660:Fmo4 UTSW 1 162809848 missense probably benign 0.05
R0737:Fmo4 UTSW 1 162808392 nonsense probably null
R1117:Fmo4 UTSW 1 162803663 missense probably benign 0.03
R1464:Fmo4 UTSW 1 162794355 missense possibly damaging 0.54
R1464:Fmo4 UTSW 1 162794355 missense possibly damaging 0.54
R1577:Fmo4 UTSW 1 162803700 missense possibly damaging 0.50
R1875:Fmo4 UTSW 1 162803618 missense possibly damaging 0.95
R1929:Fmo4 UTSW 1 162799047 missense possibly damaging 0.95
R1956:Fmo4 UTSW 1 162803690 missense probably benign 0.01
R1957:Fmo4 UTSW 1 162803690 missense probably benign 0.01
R1958:Fmo4 UTSW 1 162803690 missense probably benign 0.01
R2011:Fmo4 UTSW 1 162798889 missense probably damaging 1.00
R2030:Fmo4 UTSW 1 162794172 missense probably damaging 1.00
R2072:Fmo4 UTSW 1 162809887 missense probably benign 0.20
R2272:Fmo4 UTSW 1 162799047 missense possibly damaging 0.95
R3890:Fmo4 UTSW 1 162794055 missense probably benign 0.39
R4255:Fmo4 UTSW 1 162794326 missense probably benign 0.00
R4273:Fmo4 UTSW 1 162805179 missense probably damaging 0.97
R4760:Fmo4 UTSW 1 162809827 missense probably damaging 1.00
R5445:Fmo4 UTSW 1 162805273 missense probably benign 0.24
R5726:Fmo4 UTSW 1 162808259 critical splice donor site probably null
R5786:Fmo4 UTSW 1 162803717 missense probably benign 0.00
R6391:Fmo4 UTSW 1 162793969 nonsense probably null
R6826:Fmo4 UTSW 1 162803769 missense probably damaging 1.00
R7457:Fmo4 UTSW 1 162794103 missense probably benign 0.00
R7913:Fmo4 UTSW 1 162794172 missense possibly damaging 0.69
R8031:Fmo4 UTSW 1 162798852 nonsense probably null
R8055:Fmo4 UTSW 1 162808446 missense probably benign
R8234:Fmo4 UTSW 1 162805188 missense probably damaging 1.00
R8346:Fmo4 UTSW 1 162794223 missense probably benign 0.01
X0020:Fmo4 UTSW 1 162794378 missense probably benign 0.02
Z1177:Fmo4 UTSW 1 162803720 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTTCTGGGGCATGTACCAC -3'
(R):5'- TTATAACTTGGGAGATGCAGAACAG -3'

Sequencing Primer
(F):5'- GGGAAATCTTCTCGGTAGCTTACC -3'
(R):5'- GGGGGTGGGTGGCTAATGAC -3'
Posted On2014-06-23