Mutagenetix > Incidental Mutation

Incidental Mutation 'R1792:Pla2g4e'

201808

Institutional Source

Beutler Lab

Gene Symbol

Pla2g4e

Ensembl Gene

ENSMUSG00000050211

Gene Name

phospholipase A2, group IVE

Synonyms

Pla2epsilon, 2310026J01Rik

MMRRC Submission

039822-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1792 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120166412-120245335 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 120168474 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 803 (P803L)

Ref Sequence

ENSEMBL: ENSMUSP00000087525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090071]

AlphaFold

Q50L42

Predicted Effect

probably damaging
Transcript: ENSMUST00000090071
AA Change: P803L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000087525
Gene: ENSMUSG00000050211
AA Change: P803L

Domain	Start	End	E-Value	Type
low complexity region	61	73	N/A	INTRINSIC
C2	82	182	3.42e-14	SMART
low complexity region	191	207	N/A	INTRINSIC
PLAc	311	818	5.17e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127009

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136845

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytosolic phospholipase A2 group IV family. Members of this family are involved in regulation of membrane tubule-mediated transport. The enzyme encoded by this member of the family plays a role in trafficking through the clathrin-independent endocytic pathway. The enzyme regulates the recycling process via formation of tubules that transport internalized clathrin-independent cargo proteins back to the cell surface. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	C	T	11: 110,184,044	V1398I	probably benign	Het
Ackr3	A	T	1: 90,214,898	N360Y	probably benign	Het
Acr	T	G	15: 89,573,143	M198R	probably benign	Het
Adamts14	A	T	10: 61,218,498	M585K	probably benign	Het
Adgrb3	A	T	1: 25,228,471	C853S	probably damaging	Het
Arhgef28	G	T	13: 97,931,186	S1410R	probably benign	Het
Armc4	T	C	18: 7,286,743	T163A	probably benign	Het
Asprv1	T	A	6: 86,628,372	F67I	possibly damaging	Het
Atp8b4	T	A	2: 126,325,294	Y1095F	probably benign	Het
Cadps	A	G	14: 12,449,802	S1136P	possibly damaging	Het
Ccdc36	A	C	9: 108,404,912	S526A	possibly damaging	Het
Ccdc57	T	C	11: 120,897,881	Q380R	possibly damaging	Het
Cdc45	A	T	16: 18,807,340	D142E	probably benign	Het
Cs	A	T	10: 128,360,079	N386Y	possibly damaging	Het
Dsc3	A	T	18: 19,986,998	V201E	probably damaging	Het
Dusp26	G	T	8: 31,091,935	R19L	probably benign	Het
Esyt3	C	A	9: 99,358,116	E92*	probably null	Het
Ext2	T	C	2: 93,704,545	N625D	probably damaging	Het
Fam208b	T	C	13: 3,590,559	K193E	possibly damaging	Het
Flvcr2	A	T	12: 85,747,155	K102*	probably null	Het
Fmnl2	T	A	2: 53,042,317	S103T	possibly damaging	Het
Fmo4	T	A	1: 162,794,290	I451F	probably benign	Het
Gak	A	T	5: 108,585,531	Y47*	probably null	Het
Gbp10	A	T	5: 105,224,300	L198Q	probably damaging	Het
Gm11559	T	A	11: 99,864,929	S135T	unknown	Het
Gm14496	A	T	2: 181,996,153	D340V	probably benign	Het
Grin2a	T	C	16: 9,992,395	T47A	possibly damaging	Het
Gtf2ird1	A	T	5: 134,366,936		probably null	Het
Herc4	T	A	10: 63,245,901	M1K	probably null	Het
Hirip3	T	A	7: 126,862,620	V29E	probably damaging	Het
Hs3st5	A	G	10: 36,832,724	D85G	probably benign	Het
Htt	T	A	5: 34,907,199	S2981T	probably damaging	Het
Il20ra	G	A	10: 19,759,636	V542I	probably damaging	Het
Itgb2l	C	A	16: 96,425,082	C603F	probably damaging	Het
Klhl41	A	C	2: 69,670,802	K202N	probably benign	Het
Lct	G	A	1: 128,327,942	S121F	possibly damaging	Het
Lhx6	C	T	2: 36,087,375	G355D	probably damaging	Het
Limk2	A	G	11: 3,358,236	V121A	probably benign	Het
Med1	T	G	11: 98,157,283	K896Q	probably damaging	Het
Muc6	A	G	7: 141,634,458	F2789S	probably benign	Het
Nemf	T	A	12: 69,312,569	Y997F	probably damaging	Het
Nrap	A	G	19: 56,379,158	S296P	probably benign	Het
Nrxn1	T	C	17: 90,588,824	N961D	probably damaging	Het
Olfr220	T	C	1: 174,448,737	V38A	probably benign	Het
Olfr398	A	C	11: 73,983,847	S254A	probably benign	Het
Olfr777	A	T	10: 129,269,243	F27I	probably benign	Het
Parp14	G	A	16: 35,856,760	A946V	probably benign	Het
Pdk4	T	A	6: 5,489,166	H247L	probably damaging	Het
Pkd1l3	T	A	8: 109,632,605	V866E	probably damaging	Het
Pnisr	T	C	4: 21,860,968	V217A	possibly damaging	Het
Pole4	G	A	6: 82,652,739	P34L	unknown	Het
Pole4	G	T	6: 82,652,740	P34T	unknown	Het
Ptchd3	G	A	11: 121,841,551	W422*	probably null	Het
Rab1b	C	T	19: 5,100,485	A167T	probably benign	Het
Rasal1	T	C	5: 120,664,756	M359T	probably benign	Het
Rexo4	T	C	2: 26,960,236	N310D	probably benign	Het
Rgma	C	T	7: 73,417,837	T280M	probably damaging	Het
Rnaset2a	A	T	17: 8,145,576	I43N	probably damaging	Het
Rtcb	A	T	10: 85,942,582	V399E	probably damaging	Het
Scd4	T	G	19: 44,337,574	Y122*	probably null	Het
Sirt6	T	C	10: 81,626,521	I15V	possibly damaging	Het
Slamf8	A	T	1: 172,587,959	V104E	possibly damaging	Het
Slc12a4	A	G	8: 105,951,843	I285T	possibly damaging	Het
Slc25a13	G	A	6: 6,115,104	A207V	possibly damaging	Het
Slc6a21	T	C	7: 45,280,731	S185P	probably benign	Het
Smarcc2	A	C	10: 128,463,871	N135T	probably damaging	Het
Susd6	T	C	12: 80,874,291	S221P	probably damaging	Het
Syne1	C	T	10: 5,040,975	G8418D	probably damaging	Het
Tbc1d7	C	T	13: 43,165,377	V95I	probably benign	Het
Tcerg1l	T	C	7: 138,361,866	D225G	probably benign	Het
Tfip11	A	T	5: 112,329,397	I82F	possibly damaging	Het
Tmem41a	C	T	16: 21,936,981	G192S	probably null	Het
Trrap	G	A	5: 144,853,586	A3619T	possibly damaging	Het
Tspoap1	G	A	11: 87,765,881		probably null	Het
Wfdc21	T	C	11: 83,747,057	S11P	probably benign	Het
Zc2hc1b	A	T	10: 13,168,730	V63E	probably damaging	Het

Other mutations in Pla2g4e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00470:Pla2g4e	APN	2	120185238	missense	probably benign
IGL01712:Pla2g4e	APN	2	120189403	critical splice donor site	probably null
IGL01859:Pla2g4e	APN	2	120182733	missense	possibly damaging	0.70
IGL02334:Pla2g4e	APN	2	120187236	missense	probably benign
FR4737:Pla2g4e	UTSW	2	120244724	small deletion	probably benign
R0157:Pla2g4e	UTSW	2	120170181	missense	probably benign	0.00
R0578:Pla2g4e	UTSW	2	120244681	splice site	probably benign
R0675:Pla2g4e	UTSW	2	120200198	splice site	probably benign
R1278:Pla2g4e	UTSW	2	120168470	critical splice donor site	probably null
R1346:Pla2g4e	UTSW	2	120182772	missense	probably damaging	1.00
R1760:Pla2g4e	UTSW	2	120170046	missense	possibly damaging	0.50
R1773:Pla2g4e	UTSW	2	120244721	missense	probably benign
R2129:Pla2g4e	UTSW	2	120182811	missense	probably damaging	0.99
R2160:Pla2g4e	UTSW	2	120185206	missense	probably benign	0.00
R2191:Pla2g4e	UTSW	2	120191199	frame shift	probably null
R3901:Pla2g4e	UTSW	2	120168604	missense	probably benign	0.00
R4342:Pla2g4e	UTSW	2	120186446	intron	probably benign
R4414:Pla2g4e	UTSW	2	120182713	missense	probably benign
R4460:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4581:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4599:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4601:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4610:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4611:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4664:Pla2g4e	UTSW	2	120171188	missense	probably damaging	0.97
R4688:Pla2g4e	UTSW	2	120167933	missense	possibly damaging	0.82
R4691:Pla2g4e	UTSW	2	120174300	missense	probably damaging	1.00
R4944:Pla2g4e	UTSW	2	120171237	missense	probably benign	0.01
R5051:Pla2g4e	UTSW	2	120174304	missense	probably damaging	1.00
R5285:Pla2g4e	UTSW	2	120189504	missense	probably damaging	1.00
R5373:Pla2g4e	UTSW	2	120186395	missense	probably benign	0.30
R5374:Pla2g4e	UTSW	2	120186395	missense	probably benign	0.30
R5505:Pla2g4e	UTSW	2	120244775	missense	probably benign	0.08
R5702:Pla2g4e	UTSW	2	120188511	missense	possibly damaging	0.61
R6300:Pla2g4e	UTSW	2	120182738	missense	probably benign	0.00
R6711:Pla2g4e	UTSW	2	120171270	missense	probably benign	0.00
R6920:Pla2g4e	UTSW	2	120185314	missense	possibly damaging	0.82
R6961:Pla2g4e	UTSW	2	120174370	splice site	probably null
R6987:Pla2g4e	UTSW	2	120186380	missense	probably benign	0.01
R7028:Pla2g4e	UTSW	2	120170195	missense	probably damaging	1.00
R7138:Pla2g4e	UTSW	2	120171278	missense	probably damaging	1.00
R7300:Pla2g4e	UTSW	2	120191199	missense	probably damaging	1.00
R7355:Pla2g4e	UTSW	2	120181501	missense	possibly damaging	0.91
R7502:Pla2g4e	UTSW	2	120174338	splice site	probably null
R7849:Pla2g4e	UTSW	2	120185322	missense	probably benign	0.32
R8288:Pla2g4e	UTSW	2	120188509	critical splice donor site	probably null
R8686:Pla2g4e	UTSW	2	120244691	missense	probably damaging	0.98
R9003:Pla2g4e	UTSW	2	120176801	missense	probably benign	0.03
R9023:Pla2g4e	UTSW	2	120171237	missense	probably benign	0.01
R9261:Pla2g4e	UTSW	2	120189429	missense	probably benign	0.04
R9284:Pla2g4e	UTSW	2	120174249	splice site	probably benign
R9299:Pla2g4e	UTSW	2	120171723	missense	probably damaging	1.00
R9338:Pla2g4e	UTSW	2	120189433	missense	probably benign	0.07
R9555:Pla2g4e	UTSW	2	120244919	start gained	probably benign
R9604:Pla2g4e	UTSW	2	120185199	missense	probably benign	0.02
RF044:Pla2g4e	UTSW	2	120244724	small deletion	probably benign
Z1177:Pla2g4e	UTSW	2	120181523	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCACAGTTCCTTTCTTTCAAGAG -3'
(R):5'- AAACCTGTGAGTACTGTACCGAG -3'

Sequencing Primer
(F):5'- CTTTCAAGAGTCTACATAGCTGGG -3'
(R):5'- GTACTGTACCGAGCAGAAGATCC -3'

Posted On

2014-06-23