Incidental Mutation 'R1792:Pkd1l3'
ID201834
Institutional Source Beutler Lab
Gene Symbol Pkd1l3
Ensembl Gene ENSMUSG00000048827
Gene Namepolycystic kidney disease 1 like 3
Synonyms
MMRRC Submission 039822-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1792 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location109614517-109674386 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109632605 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 866 (V866E)
Ref Sequence ENSEMBL: ENSMUSP00000148592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057344] [ENSMUST00000109242] [ENSMUST00000212537]
Predicted Effect probably damaging
Transcript: ENSMUST00000057344
AA Change: V866E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051512
Gene: ENSMUSG00000048827
AA Change: V866E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CLECT 26 142 4.25e-1 SMART
internal_repeat_2 143 245 2.25e-8 PROSPERO
low complexity region 246 270 N/A INTRINSIC
low complexity region 272 296 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 324 348 N/A INTRINSIC
internal_repeat_1 349 431 1.22e-8 PROSPERO
internal_repeat_2 378 466 2.25e-8 PROSPERO
internal_repeat_1 518 731 1.22e-8 PROSPERO
GPS 1007 1056 3.62e-5 SMART
transmembrane domain 1075 1094 N/A INTRINSIC
LH2 1119 1238 1.01e-9 SMART
transmembrane domain 1282 1304 N/A INTRINSIC
transmembrane domain 1319 1341 N/A INTRINSIC
low complexity region 1398 1408 N/A INTRINSIC
low complexity region 1451 1460 N/A INTRINSIC
low complexity region 1484 1497 N/A INTRINSIC
transmembrane domain 1534 1556 N/A INTRINSIC
transmembrane domain 1576 1595 N/A INTRINSIC
Pfam:PKD_channel 1695 2110 2.8e-86 PFAM
Pfam:Ion_trans 1858 2114 2.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109242
AA Change: V876E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104865
Gene: ENSMUSG00000048827
AA Change: V876E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CLECT 26 142 4.25e-1 SMART
internal_repeat_2 143 245 2.63e-8 PROSPERO
low complexity region 246 270 N/A INTRINSIC
low complexity region 272 296 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 324 348 N/A INTRINSIC
internal_repeat_1 349 440 3.96e-14 PROSPERO
internal_repeat_2 378 466 2.63e-8 PROSPERO
internal_repeat_1 518 724 3.96e-14 PROSPERO
GPS 1017 1066 3.62e-5 SMART
transmembrane domain 1085 1104 N/A INTRINSIC
LH2 1129 1248 1.01e-9 SMART
transmembrane domain 1292 1314 N/A INTRINSIC
transmembrane domain 1329 1351 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
low complexity region 1461 1470 N/A INTRINSIC
low complexity region 1494 1507 N/A INTRINSIC
transmembrane domain 1544 1566 N/A INTRINSIC
transmembrane domain 1586 1605 N/A INTRINSIC
Pfam:PKD_channel 1705 2120 1.3e-86 PFAM
Pfam:Ion_trans 1868 2124 4.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212537
AA Change: V866E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213034
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores.[provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal and exhibit normal taste responsiveness in various behavioral and electrophysiological tests of taste function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 C T 11: 110,184,044 V1398I probably benign Het
Ackr3 A T 1: 90,214,898 N360Y probably benign Het
Acr T G 15: 89,573,143 M198R probably benign Het
Adamts14 A T 10: 61,218,498 M585K probably benign Het
Adgrb3 A T 1: 25,228,471 C853S probably damaging Het
Arhgef28 G T 13: 97,931,186 S1410R probably benign Het
Armc4 T C 18: 7,286,743 T163A probably benign Het
Asprv1 T A 6: 86,628,372 F67I possibly damaging Het
Atp8b4 T A 2: 126,325,294 Y1095F probably benign Het
Cadps A G 14: 12,449,802 S1136P possibly damaging Het
Ccdc36 A C 9: 108,404,912 S526A possibly damaging Het
Ccdc57 T C 11: 120,897,881 Q380R possibly damaging Het
Cdc45 A T 16: 18,807,340 D142E probably benign Het
Cs A T 10: 128,360,079 N386Y possibly damaging Het
Dsc3 A T 18: 19,986,998 V201E probably damaging Het
Dusp26 G T 8: 31,091,935 R19L probably benign Het
Esyt3 C A 9: 99,358,116 E92* probably null Het
Ext2 T C 2: 93,704,545 N625D probably damaging Het
Fam208b T C 13: 3,590,559 K193E possibly damaging Het
Flvcr2 A T 12: 85,747,155 K102* probably null Het
Fmnl2 T A 2: 53,042,317 S103T possibly damaging Het
Fmo4 T A 1: 162,794,290 I451F probably benign Het
Gak A T 5: 108,585,531 Y47* probably null Het
Gbp10 A T 5: 105,224,300 L198Q probably damaging Het
Gm11559 T A 11: 99,864,929 S135T unknown Het
Gm14496 A T 2: 181,996,153 D340V probably benign Het
Grin2a T C 16: 9,992,395 T47A possibly damaging Het
Gtf2ird1 A T 5: 134,366,936 probably null Het
Herc4 T A 10: 63,245,901 M1K probably null Het
Hirip3 T A 7: 126,862,620 V29E probably damaging Het
Hs3st5 A G 10: 36,832,724 D85G probably benign Het
Htt T A 5: 34,907,199 S2981T probably damaging Het
Il20ra G A 10: 19,759,636 V542I probably damaging Het
Itgb2l C A 16: 96,425,082 C603F probably damaging Het
Klhl41 A C 2: 69,670,802 K202N probably benign Het
Lct G A 1: 128,327,942 S121F possibly damaging Het
Lhx6 C T 2: 36,087,375 G355D probably damaging Het
Limk2 A G 11: 3,358,236 V121A probably benign Het
Med1 T G 11: 98,157,283 K896Q probably damaging Het
Muc6 A G 7: 141,634,458 F2789S probably benign Het
Nemf T A 12: 69,312,569 Y997F probably damaging Het
Nrap A G 19: 56,379,158 S296P probably benign Het
Nrxn1 T C 17: 90,588,824 N961D probably damaging Het
Olfr220 T C 1: 174,448,737 V38A probably benign Het
Olfr398 A C 11: 73,983,847 S254A probably benign Het
Olfr777 A T 10: 129,269,243 F27I probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdk4 T A 6: 5,489,166 H247L probably damaging Het
Pla2g4e G A 2: 120,168,474 P803L probably damaging Het
Pnisr T C 4: 21,860,968 V217A possibly damaging Het
Pole4 G A 6: 82,652,739 P34L unknown Het
Pole4 G T 6: 82,652,740 P34T unknown Het
Ptchd3 G A 11: 121,841,551 W422* probably null Het
Rab1b C T 19: 5,100,485 A167T probably benign Het
Rasal1 T C 5: 120,664,756 M359T probably benign Het
Rexo4 T C 2: 26,960,236 N310D probably benign Het
Rgma C T 7: 73,417,837 T280M probably damaging Het
Rnaset2a A T 17: 8,145,576 I43N probably damaging Het
Rtcb A T 10: 85,942,582 V399E probably damaging Het
Scd4 T G 19: 44,337,574 Y122* probably null Het
Sirt6 T C 10: 81,626,521 I15V possibly damaging Het
Slamf8 A T 1: 172,587,959 V104E possibly damaging Het
Slc12a4 A G 8: 105,951,843 I285T possibly damaging Het
Slc25a13 G A 6: 6,115,104 A207V possibly damaging Het
Slc6a21 T C 7: 45,280,731 S185P probably benign Het
Smarcc2 A C 10: 128,463,871 N135T probably damaging Het
Susd6 T C 12: 80,874,291 S221P probably damaging Het
Syne1 C T 10: 5,040,975 G8418D probably damaging Het
Tbc1d7 C T 13: 43,165,377 V95I probably benign Het
Tcerg1l T C 7: 138,361,866 D225G probably benign Het
Tfip11 A T 5: 112,329,397 I82F possibly damaging Het
Tmem41a C T 16: 21,936,981 G192S probably null Het
Trrap G A 5: 144,853,586 A3619T possibly damaging Het
Tspoap1 G A 11: 87,765,881 probably null Het
Wfdc21 T C 11: 83,747,057 S11P probably benign Het
Zc2hc1b A T 10: 13,168,730 V63E probably damaging Het
Other mutations in Pkd1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pkd1l3 APN 8 109630237 missense possibly damaging 0.53
IGL00562:Pkd1l3 APN 8 109656147 missense possibly damaging 0.53
IGL00563:Pkd1l3 APN 8 109656147 missense possibly damaging 0.53
IGL01061:Pkd1l3 APN 8 109638706 missense probably damaging 1.00
IGL01105:Pkd1l3 APN 8 109662241 missense possibly damaging 0.81
IGL01574:Pkd1l3 APN 8 109623771 missense probably benign 0.01
IGL01597:Pkd1l3 APN 8 109623521 missense probably benign 0.33
IGL01634:Pkd1l3 APN 8 109667525 critical splice acceptor site probably null
IGL01645:Pkd1l3 APN 8 109635302 missense possibly damaging 0.59
IGL01770:Pkd1l3 APN 8 109648502 critical splice acceptor site probably null
IGL01837:Pkd1l3 APN 8 109630166 missense possibly damaging 0.85
IGL01862:Pkd1l3 APN 8 109631276 critical splice acceptor site probably null
IGL01938:Pkd1l3 APN 8 109635301 missense probably benign 0.00
IGL01990:Pkd1l3 APN 8 109660806 missense probably damaging 1.00
IGL02056:Pkd1l3 APN 8 109631378 missense probably benign 0.14
IGL02069:Pkd1l3 APN 8 109635380 missense probably damaging 1.00
IGL02086:Pkd1l3 APN 8 109665585 missense probably damaging 1.00
IGL02152:Pkd1l3 APN 8 109669292 missense probably damaging 1.00
IGL02209:Pkd1l3 APN 8 109638664 missense probably damaging 1.00
IGL02213:Pkd1l3 APN 8 109631345 missense probably damaging 1.00
IGL02218:Pkd1l3 APN 8 109660802 missense possibly damaging 0.92
IGL02225:Pkd1l3 APN 8 109638678 missense probably damaging 1.00
IGL02252:Pkd1l3 APN 8 109631076 missense possibly damaging 0.92
IGL02351:Pkd1l3 APN 8 109646497 unclassified probably benign
IGL02358:Pkd1l3 APN 8 109646497 unclassified probably benign
IGL02369:Pkd1l3 APN 8 109616345 missense unknown
IGL02481:Pkd1l3 APN 8 109614782 missense unknown
IGL02505:Pkd1l3 APN 8 109633216 missense probably damaging 1.00
IGL02506:Pkd1l3 APN 8 109647500 missense probably damaging 1.00
IGL02535:Pkd1l3 APN 8 109640890 nonsense probably null
IGL02715:Pkd1l3 APN 8 109626826 missense probably damaging 0.96
IGL02979:Pkd1l3 APN 8 109662104 splice site probably benign
IGL03059:Pkd1l3 APN 8 109648367 missense probably damaging 1.00
IGL03090:Pkd1l3 APN 8 109655533 nonsense probably null
IGL03206:Pkd1l3 APN 8 109623713 missense probably benign 0.18
IGL03328:Pkd1l3 APN 8 109662106 splice site probably benign
PIT4453001:Pkd1l3 UTSW 8 109660801 missense probably damaging 0.99
PIT4468001:Pkd1l3 UTSW 8 109664499 missense possibly damaging 0.85
R0001:Pkd1l3 UTSW 8 109628633 splice site probably benign
R0066:Pkd1l3 UTSW 8 109620471 missense unknown
R0066:Pkd1l3 UTSW 8 109620471 missense unknown
R0233:Pkd1l3 UTSW 8 109650780 nonsense probably null
R0233:Pkd1l3 UTSW 8 109650780 nonsense probably null
R0255:Pkd1l3 UTSW 8 109638754 missense probably damaging 1.00
R0288:Pkd1l3 UTSW 8 109646499 splice site probably null
R0311:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0311:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0403:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0403:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0441:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0446:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0465:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0465:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0466:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0467:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0468:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0488:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0488:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0515:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0534:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0650:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0689:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R1422:Pkd1l3 UTSW 8 109621708 missense unknown
R1464:Pkd1l3 UTSW 8 109636427 splice site probably benign
R1467:Pkd1l3 UTSW 8 109616368 missense unknown
R1467:Pkd1l3 UTSW 8 109616368 missense unknown
R1469:Pkd1l3 UTSW 8 109646953 missense possibly damaging 0.72
R1469:Pkd1l3 UTSW 8 109646953 missense possibly damaging 0.72
R1509:Pkd1l3 UTSW 8 109640770 missense probably damaging 0.99
R1561:Pkd1l3 UTSW 8 109614813 missense unknown
R1574:Pkd1l3 UTSW 8 109614813 missense unknown
R1599:Pkd1l3 UTSW 8 109636384 missense probably benign 0.01
R1688:Pkd1l3 UTSW 8 109623818 missense probably benign 0.18
R1818:Pkd1l3 UTSW 8 109648406 missense probably benign 0.03
R1896:Pkd1l3 UTSW 8 109624199 missense possibly damaging 0.92
R2105:Pkd1l3 UTSW 8 109647573 nonsense probably null
R2185:Pkd1l3 UTSW 8 109633195 missense possibly damaging 0.95
R2192:Pkd1l3 UTSW 8 109620524 missense unknown
R2260:Pkd1l3 UTSW 8 109623636 missense probably benign 0.18
R2363:Pkd1l3 UTSW 8 109628709 missense probably benign 0.01
R2418:Pkd1l3 UTSW 8 109670721 makesense probably null
R2435:Pkd1l3 UTSW 8 109650702 missense probably benign 0.07
R2443:Pkd1l3 UTSW 8 109623815 missense probably benign 0.18
R2850:Pkd1l3 UTSW 8 109623990 missense possibly damaging 0.92
R2910:Pkd1l3 UTSW 8 109667636 splice site probably benign
R3755:Pkd1l3 UTSW 8 109632539 missense probably damaging 1.00
R3791:Pkd1l3 UTSW 8 109636317 missense probably damaging 0.99
R3905:Pkd1l3 UTSW 8 109646879 missense probably benign 0.02
R4027:Pkd1l3 UTSW 8 109623971 missense possibly damaging 0.68
R4028:Pkd1l3 UTSW 8 109623971 missense possibly damaging 0.68
R4029:Pkd1l3 UTSW 8 109623971 missense possibly damaging 0.68
R4274:Pkd1l3 UTSW 8 109624119 missense possibly damaging 0.92
R4461:Pkd1l3 UTSW 8 109632713 intron probably null
R4893:Pkd1l3 UTSW 8 109638394 missense probably benign 0.15
R4907:Pkd1l3 UTSW 8 109640843 missense probably damaging 0.99
R5037:Pkd1l3 UTSW 8 109665636 missense probably damaging 1.00
R5045:Pkd1l3 UTSW 8 109623155 missense unknown
R5207:Pkd1l3 UTSW 8 109633191 missense probably damaging 1.00
R5307:Pkd1l3 UTSW 8 109640792 missense probably damaging 1.00
R5408:Pkd1l3 UTSW 8 109667052 missense probably damaging 1.00
R5595:Pkd1l3 UTSW 8 109655520 missense probably damaging 1.00
R5615:Pkd1l3 UTSW 8 109630210 missense probably benign
R5623:Pkd1l3 UTSW 8 109623719 missense possibly damaging 0.53
R5896:Pkd1l3 UTSW 8 109626836 missense probably damaging 1.00
R6101:Pkd1l3 UTSW 8 109640846 missense probably damaging 1.00
R6105:Pkd1l3 UTSW 8 109640846 missense probably damaging 1.00
R6170:Pkd1l3 UTSW 8 109623179 missense unknown
R6330:Pkd1l3 UTSW 8 109646909 missense probably benign 0.00
R6346:Pkd1l3 UTSW 8 109631384 missense probably damaging 0.98
R6395:Pkd1l3 UTSW 8 109623963 missense probably benign 0.20
R6475:Pkd1l3 UTSW 8 109623212 missense unknown
R6480:Pkd1l3 UTSW 8 109638387 nonsense probably null
R6519:Pkd1l3 UTSW 8 109628772 missense probably benign
R6654:Pkd1l3 UTSW 8 109624283 missense probably benign 0.23
R6717:Pkd1l3 UTSW 8 109614769 missense unknown
R6733:Pkd1l3 UTSW 8 109648494 splice site probably null
R6753:Pkd1l3 UTSW 8 109624449 missense probably damaging 1.00
R6777:Pkd1l3 UTSW 8 109626814 missense probably benign 0.00
R6901:Pkd1l3 UTSW 8 109614614 missense unknown
R6975:Pkd1l3 UTSW 8 109660907 missense possibly damaging 0.73
R6991:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7018:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7083:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7139:Pkd1l3 UTSW 8 109636340 missense probably damaging 0.96
R7153:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7235:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7238:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7252:Pkd1l3 UTSW 8 109660698 missense probably benign 0.01
R7296:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7309:Pkd1l3 UTSW 8 109648261 synonymous probably null
R7362:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7462:Pkd1l3 UTSW 8 109628777 missense probably benign 0.00
R7470:Pkd1l3 UTSW 8 109638376 missense probably benign 0.09
R7478:Pkd1l3 UTSW 8 109633315 missense probably damaging 1.00
R7483:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7516:Pkd1l3 UTSW 8 109635229 missense probably damaging 1.00
R7537:Pkd1l3 UTSW 8 109623788 small deletion probably benign
R7553:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7559:Pkd1l3 UTSW 8 109624440 missense probably benign 0.03
R7650:Pkd1l3 UTSW 8 109672585 missense probably benign 0.23
R7654:Pkd1l3 UTSW 8 109638417 missense probably damaging 1.00
R7742:Pkd1l3 UTSW 8 109614572 missense unknown
R7749:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7751:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7755:Pkd1l3 UTSW 8 109630166 missense possibly damaging 0.85
R7816:Pkd1l3 UTSW 8 109624195 small deletion probably benign
RF016:Pkd1l3 UTSW 8 109623542 missense probably benign 0.18
RF029:Pkd1l3 UTSW 8 109624195 small deletion probably benign
X0026:Pkd1l3 UTSW 8 109614553 missense probably null
Z31818:Pkd1l3 UTSW 8 109669292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCACCTGACACAGTGGGG -3'
(R):5'- AAATGCCAAGTTGTTGTATCTTCCC -3'

Sequencing Primer
(F):5'- GGTCCTGAGTTCAAATCCCAG -3'
(R):5'- CATCCTGTATCCCAGCACGG -3'
Posted On2014-06-23