Incidental Mutation 'R0091:Sag'
ID20185
Institutional Source Beutler Lab
Gene Symbol Sag
Ensembl Gene ENSMUSG00000056055
Gene NameS-antigen, retina and pineal gland (arrestin)
Synonymsarrestin 1, A930001K18Rik, arrestin, visual arrestin 1, Arr1, rod arrestin
MMRRC Submission 038378-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0091 (G1)
Quality Score225
Status Validated (trace)
Chromosome1
Chromosomal Location87803680-87845158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87814680 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 58 (V58A)
Ref Sequence ENSEMBL: ENSMUSP00000136729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077772] [ENSMUST00000177757]
Predicted Effect probably damaging
Transcript: ENSMUST00000077772
AA Change: V58A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000076948
Gene: ENSMUSG00000056055
AA Change: V58A

DomainStartEndE-ValueType
Pfam:Arrestin_N 23 181 2.8e-36 PFAM
Arrestin_C 200 361 8.24e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156381
Predicted Effect probably damaging
Transcript: ENSMUST00000177757
AA Change: V58A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136729
Gene: ENSMUSG00000056055
AA Change: V58A

DomainStartEndE-ValueType
Pfam:Arrestin_N 23 181 2.7e-34 PFAM
Arrestin_C 200 361 8.24e-30 SMART
Meta Mutation Damage Score 0.2095 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.4%
  • 20x: 84.5%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. S-arrestin, also known as S-antigen, is a major soluble photoreceptor protein that is involved in desensitization of the photoactivated transduction cascade. It is expressed in the retina and the pineal gland and inhibits coupling of rhodopsin to transducin in vitro. Additionally, S-arrestin is highly antigenic, and is capable of inducing experimental autoimmune uveoretinitis. Mutations in this gene have been associated with Oguchi disease, a rare autosomal recessive form of night blindness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormalities in retinal rod cell outer segment morphology and rod electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,138,530 S278P possibly damaging Het
Adam11 A G 11: 102,772,839 Y281C probably damaging Het
Adam6a G T 12: 113,544,229 R74L possibly damaging Het
Adcy5 T C 16: 35,270,998 probably null Het
Adrb2 A G 18: 62,179,019 L245P probably benign Het
Aebp2 T C 6: 140,644,074 probably null Het
Arhgap23 A G 11: 97,452,244 T240A probably benign Het
Atp10a T C 7: 58,774,046 probably benign Het
Atp13a4 T A 16: 29,455,395 Y416F probably damaging Het
Atp5g2 A C 15: 102,663,057 L133R probably damaging Het
Bicral A T 17: 46,825,307 Y326N probably damaging Het
Chst4 T C 8: 110,030,665 S189G probably damaging Het
Cnot1 A T 8: 95,763,144 I477N probably damaging Het
Col7a1 G T 9: 108,967,506 probably benign Het
Dchs1 A G 7: 105,766,094 probably benign Het
Dcn A G 10: 97,506,689 N169S probably benign Het
Dnajc6 T C 4: 101,616,777 probably benign Het
Egln3 A G 12: 54,181,646 F225L probably benign Het
Erap1 G A 13: 74,668,052 R100Q possibly damaging Het
Erc2 A T 14: 27,776,824 probably null Het
Fto G A 8: 91,441,807 probably null Het
Gdap1l1 C T 2: 163,446,091 P80S probably damaging Het
Gm1123 T C 9: 99,023,352 E35G possibly damaging Het
Hhipl1 A G 12: 108,321,897 probably benign Het
Ift80 A T 3: 68,914,675 L679Q probably damaging Het
Il18 A G 9: 50,576,713 probably benign Het
Inhbb T C 1: 119,417,395 Y388C probably damaging Het
Kmt2d G T 15: 98,844,479 probably benign Het
Krt20 A G 11: 99,437,814 V95A probably damaging Het
Lck A T 4: 129,555,681 S274R possibly damaging Het
Lrp1 T A 10: 127,540,979 N4243I probably damaging Het
Lrrfip2 G A 9: 111,214,243 V506I probably damaging Het
Ltbp2 A G 12: 84,793,733 C1000R probably damaging Het
Matn3 G A 12: 8,952,105 D106N probably damaging Het
Micalcl A G 7: 112,381,296 E49G probably benign Het
Mmadhc A G 2: 50,292,857 S36P probably damaging Het
Morn1 T C 4: 155,145,172 Y433H probably damaging Het
Mpo A G 11: 87,801,610 M525V probably benign Het
Myo5a C T 9: 75,161,492 R659C probably damaging Het
Obox6 T C 7: 15,834,439 S171G probably benign Het
Olfr1280 T A 2: 111,316,173 D231E probably benign Het
Olfr347 A G 2: 36,734,905 N195D probably damaging Het
Olfr998 A T 2: 85,591,352 N271Y probably benign Het
P2ry14 A G 3: 59,115,893 Y49H probably benign Het
Papss2 C T 19: 32,633,902 T17I possibly damaging Het
Pcid2 T C 8: 13,085,392 T206A probably benign Het
Pex6 A G 17: 46,711,918 E140G probably damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prdx2 T G 8: 84,971,701 probably benign Het
Ptbp2 A T 3: 119,720,661 L471Q probably damaging Het
Rbm33 T A 5: 28,352,606 D232E possibly damaging Het
Rnf214 T A 9: 45,898,493 probably null Het
Rora G A 9: 69,374,048 R314H probably damaging Het
Rufy4 T C 1: 74,128,936 probably benign Het
Serpina3i C T 12: 104,265,164 T20M probably damaging Het
Slc4a5 A G 6: 83,277,555 N578S probably benign Het
Soat2 A G 15: 102,158,139 Y285C probably damaging Het
Syk A G 13: 52,640,733 Y478C probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tas2r126 A T 6: 42,435,102 M190L probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttc19 A G 11: 62,309,084 D218G probably damaging Het
Tut1 T C 19: 8,965,436 V629A probably damaging Het
Txndc11 T C 16: 11,088,104 N521D probably benign Het
Ushbp1 T C 8: 71,388,970 E405G possibly damaging Het
Usp46 C T 5: 74,003,257 R246Q probably benign Het
Utrn T C 10: 12,735,204 D469G probably damaging Het
Vmn2r104 T A 17: 20,041,813 I352F possibly damaging Het
Wdr4 G A 17: 31,496,916 T398I probably benign Het
Ythdc1 T A 5: 86,820,701 probably benign Het
Other mutations in Sag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Sag APN 1 87824424 critical splice acceptor site probably null
IGL00822:Sag APN 1 87845026 splice site probably null
IGL01140:Sag APN 1 87823364 missense probably benign 0.22
IGL01612:Sag APN 1 87805349 missense probably damaging 0.98
IGL02183:Sag APN 1 87828475 splice site probably null
IGL02893:Sag APN 1 87834593 missense probably benign 0.01
R0049:Sag UTSW 1 87834618 missense probably damaging 0.99
R0049:Sag UTSW 1 87834618 missense probably damaging 0.99
R0531:Sag UTSW 1 87834629 critical splice donor site probably null
R0609:Sag UTSW 1 87812991 missense probably damaging 0.98
R1328:Sag UTSW 1 87810294 splice site probably benign
R1395:Sag UTSW 1 87828441 missense probably benign 0.01
R1748:Sag UTSW 1 87831940 missense probably damaging 1.00
R1858:Sag UTSW 1 87814848 missense probably benign
R2020:Sag UTSW 1 87805315 missense probably damaging 1.00
R3854:Sag UTSW 1 87824518 splice site probably benign
R4021:Sag UTSW 1 87821305 critical splice acceptor site probably null
R4298:Sag UTSW 1 87845015 missense probably benign
R4630:Sag UTSW 1 87834618 missense probably damaging 0.99
R5352:Sag UTSW 1 87812993 missense probably benign 0.01
R5680:Sag UTSW 1 87821337 missense possibly damaging 0.83
R6164:Sag UTSW 1 87824453 missense probably damaging 1.00
R6407:Sag UTSW 1 87814806 missense probably benign
R7431:Sag UTSW 1 87821337 missense possibly damaging 0.83
R7548:Sag UTSW 1 87844916 missense probably benign 0.01
R8122:Sag UTSW 1 87834567 missense probably damaging 1.00
R8679:Sag UTSW 1 87810310 missense probably benign 0.27
R8723:Sag UTSW 1 87823453 critical splice donor site probably null
R8878:Sag UTSW 1 87828436 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCATTTCTTCCAGGCAGCAGAGAC -3'
(R):5'- AGGGTGCAATTTACAGGCCAACAG -3'

Sequencing Primer
(F):5'- GCAGCAGAGACTGGCAC -3'
(R):5'- CAATTTACAGGCCAACAGATGTG -3'
Posted On2013-04-11