Incidental Mutation 'R1792:Ccdc57'
ID201860
Institutional Source Beutler Lab
Gene Symbol Ccdc57
Ensembl Gene ENSMUSG00000048445
Gene Namecoiled-coil domain containing 57
Synonyms4933434G05Rik
MMRRC Submission 039822-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1792 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120826529-120932872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120897881 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 380 (Q380R)
Ref Sequence ENSEMBL: ENSMUSP00000050996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056781]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056781
AA Change: Q380R

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050996
Gene: ENSMUSG00000048445
AA Change: Q380R

DomainStartEndE-ValueType
coiled coil region 14 174 N/A INTRINSIC
coiled coil region 198 350 N/A INTRINSIC
low complexity region 356 365 N/A INTRINSIC
coiled coil region 380 489 N/A INTRINSIC
coiled coil region 519 548 N/A INTRINSIC
coiled coil region 575 607 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
internal_repeat_1 657 677 1.17e-5 PROSPERO
low complexity region 763 774 N/A INTRINSIC
low complexity region 787 798 N/A INTRINSIC
internal_repeat_1 863 883 1.17e-5 PROSPERO
low complexity region 915 923 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 C T 11: 110,184,044 V1398I probably benign Het
Ackr3 A T 1: 90,214,898 N360Y probably benign Het
Acr T G 15: 89,573,143 M198R probably benign Het
Adamts14 A T 10: 61,218,498 M585K probably benign Het
Adgrb3 A T 1: 25,228,471 C853S probably damaging Het
Arhgef28 G T 13: 97,931,186 S1410R probably benign Het
Armc4 T C 18: 7,286,743 T163A probably benign Het
Asprv1 T A 6: 86,628,372 F67I possibly damaging Het
Atp8b4 T A 2: 126,325,294 Y1095F probably benign Het
Cadps A G 14: 12,449,802 S1136P possibly damaging Het
Ccdc36 A C 9: 108,404,912 S526A possibly damaging Het
Cdc45 A T 16: 18,807,340 D142E probably benign Het
Cs A T 10: 128,360,079 N386Y possibly damaging Het
Dsc3 A T 18: 19,986,998 V201E probably damaging Het
Dusp26 G T 8: 31,091,935 R19L probably benign Het
Esyt3 C A 9: 99,358,116 E92* probably null Het
Ext2 T C 2: 93,704,545 N625D probably damaging Het
Fam208b T C 13: 3,590,559 K193E possibly damaging Het
Flvcr2 A T 12: 85,747,155 K102* probably null Het
Fmnl2 T A 2: 53,042,317 S103T possibly damaging Het
Fmo4 T A 1: 162,794,290 I451F probably benign Het
Gak A T 5: 108,585,531 Y47* probably null Het
Gbp10 A T 5: 105,224,300 L198Q probably damaging Het
Gm11559 T A 11: 99,864,929 S135T unknown Het
Gm14496 A T 2: 181,996,153 D340V probably benign Het
Grin2a T C 16: 9,992,395 T47A possibly damaging Het
Gtf2ird1 A T 5: 134,366,936 probably null Het
Herc4 T A 10: 63,245,901 M1K probably null Het
Hirip3 T A 7: 126,862,620 V29E probably damaging Het
Hs3st5 A G 10: 36,832,724 D85G probably benign Het
Htt T A 5: 34,907,199 S2981T probably damaging Het
Il20ra G A 10: 19,759,636 V542I probably damaging Het
Itgb2l C A 16: 96,425,082 C603F probably damaging Het
Klhl41 A C 2: 69,670,802 K202N probably benign Het
Lct G A 1: 128,327,942 S121F possibly damaging Het
Lhx6 C T 2: 36,087,375 G355D probably damaging Het
Limk2 A G 11: 3,358,236 V121A probably benign Het
Med1 T G 11: 98,157,283 K896Q probably damaging Het
Muc6 A G 7: 141,634,458 F2789S probably benign Het
Nemf T A 12: 69,312,569 Y997F probably damaging Het
Nrap A G 19: 56,379,158 S296P probably benign Het
Nrxn1 T C 17: 90,588,824 N961D probably damaging Het
Olfr220 T C 1: 174,448,737 V38A probably benign Het
Olfr398 A C 11: 73,983,847 S254A probably benign Het
Olfr777 A T 10: 129,269,243 F27I probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdk4 T A 6: 5,489,166 H247L probably damaging Het
Pkd1l3 T A 8: 109,632,605 V866E probably damaging Het
Pla2g4e G A 2: 120,168,474 P803L probably damaging Het
Pnisr T C 4: 21,860,968 V217A possibly damaging Het
Pole4 G A 6: 82,652,739 P34L unknown Het
Pole4 G T 6: 82,652,740 P34T unknown Het
Ptchd3 G A 11: 121,841,551 W422* probably null Het
Rab1b C T 19: 5,100,485 A167T probably benign Het
Rasal1 T C 5: 120,664,756 M359T probably benign Het
Rexo4 T C 2: 26,960,236 N310D probably benign Het
Rgma C T 7: 73,417,837 T280M probably damaging Het
Rnaset2a A T 17: 8,145,576 I43N probably damaging Het
Rtcb A T 10: 85,942,582 V399E probably damaging Het
Scd4 T G 19: 44,337,574 Y122* probably null Het
Sirt6 T C 10: 81,626,521 I15V possibly damaging Het
Slamf8 A T 1: 172,587,959 V104E possibly damaging Het
Slc12a4 A G 8: 105,951,843 I285T possibly damaging Het
Slc25a13 G A 6: 6,115,104 A207V possibly damaging Het
Slc6a21 T C 7: 45,280,731 S185P probably benign Het
Smarcc2 A C 10: 128,463,871 N135T probably damaging Het
Susd6 T C 12: 80,874,291 S221P probably damaging Het
Syne1 C T 10: 5,040,975 G8418D probably damaging Het
Tbc1d7 C T 13: 43,165,377 V95I probably benign Het
Tcerg1l T C 7: 138,361,866 D225G probably benign Het
Tfip11 A T 5: 112,329,397 I82F possibly damaging Het
Tmem41a C T 16: 21,936,981 G192S probably null Het
Trrap G A 5: 144,853,586 A3619T possibly damaging Het
Tspoap1 G A 11: 87,765,881 probably null Het
Wfdc21 T C 11: 83,747,057 S11P probably benign Het
Zc2hc1b A T 10: 13,168,730 V63E probably damaging Het
Other mutations in Ccdc57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ccdc57 APN 11 120860469 missense possibly damaging 0.94
IGL01069:Ccdc57 APN 11 120861259 missense probably benign 0.06
IGL02065:Ccdc57 APN 11 120873760 missense possibly damaging 0.85
IGL02143:Ccdc57 APN 11 120861243 nonsense probably null
R0265:Ccdc57 UTSW 11 120921811 missense probably benign 0.00
R1184:Ccdc57 UTSW 11 120873811 splice site probably benign
R1834:Ccdc57 UTSW 11 120861219 missense probably benign 0.07
R1852:Ccdc57 UTSW 11 120921673 missense probably damaging 0.98
R1914:Ccdc57 UTSW 11 120903308 splice site probably benign
R2146:Ccdc57 UTSW 11 120885225 splice site probably benign
R2341:Ccdc57 UTSW 11 120860523 missense probably benign 0.00
R3013:Ccdc57 UTSW 11 120861199 missense probably benign 0.01
R4798:Ccdc57 UTSW 11 120881857 missense possibly damaging 0.73
R4821:Ccdc57 UTSW 11 120860399 critical splice donor site probably null
R4869:Ccdc57 UTSW 11 120903518 splice site probably null
R4964:Ccdc57 UTSW 11 120861152 missense probably benign 0.17
R4966:Ccdc57 UTSW 11 120861152 missense probably benign 0.17
R5204:Ccdc57 UTSW 11 120886062 missense possibly damaging 0.73
R5993:Ccdc57 UTSW 11 120894724 missense possibly damaging 0.85
R6072:Ccdc57 UTSW 11 120902075 missense probably damaging 0.98
R6404:Ccdc57 UTSW 11 120894712 missense probably benign 0.10
R6877:Ccdc57 UTSW 11 120873702 missense probably benign 0.00
R7074:Ccdc57 UTSW 11 120903374 missense possibly damaging 0.94
R7102:Ccdc57 UTSW 11 120921731 nonsense probably null
R7311:Ccdc57 UTSW 11 120873741 missense probably benign
R8087:Ccdc57 UTSW 11 120897879 missense probably benign
R8111:Ccdc57 UTSW 11 120878887 missense probably damaging 0.99
R8164:Ccdc57 UTSW 11 120897962 missense probably benign 0.00
R8273:Ccdc57 UTSW 11 120921773 missense probably damaging 1.00
R8316:Ccdc57 UTSW 11 120885916 missense probably damaging 0.98
R8323:Ccdc57 UTSW 11 120897924 missense possibly damaging 0.66
R8388:Ccdc57 UTSW 11 120826918 missense probably benign
R8768:Ccdc57 UTSW 11 120897962 missense probably benign 0.00
R8957:Ccdc57 UTSW 11 120886035 missense probably benign
Z1176:Ccdc57 UTSW 11 120860488 missense possibly damaging 0.89
Z1176:Ccdc57 UTSW 11 120861138 missense probably null
Predicted Primers PCR Primer
(F):5'- ATCTGCTTTCAAACCATTGACC -3'
(R):5'- TTTTGAGAGGGCTGGCCAAC -3'

Sequencing Primer
(F):5'- GCTTTCAAACCATTGACCATTCC -3'
(R):5'- GCCAACTGTGTGTGTGCTCC -3'
Posted On2014-06-23