Incidental Mutation 'R1792:Nemf'
ID 201862
Institutional Source Beutler Lab
Gene Symbol Nemf
Ensembl Gene ENSMUSG00000020982
Gene Name nuclear export mediator factor
Synonyms 1500011I12Rik, 4933405E14Rik, Sdccag1
MMRRC Submission 039822-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1792 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 69310522-69357165 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 69312569 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 997 (Y997F)
Ref Sequence ENSEMBL: ENSMUSP00000021368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021362] [ENSMUST00000021368] [ENSMUST00000021368]
AlphaFold Q8CCP0
Predicted Effect probably benign
Transcript: ENSMUST00000021362
SMART Domains Protein: ENSMUSP00000021362
Gene: ENSMUSG00000020978

DomainStartEndE-ValueType
internal_repeat_1 7 117 3.66e-6 PROSPERO
internal_repeat_2 66 163 6.25e-5 PROSPERO
Pfam:Kelch_1 217 258 1.4e-6 PFAM
Pfam:Kelch_2 217 262 1.2e-7 PFAM
Pfam:Kelch_4 217 266 8.4e-8 PFAM
Pfam:Kelch_3 227 276 5.1e-9 PFAM
Pfam:Kelch_5 265 305 1.4e-6 PFAM
Pfam:Kelch_4 267 310 2e-9 PFAM
Pfam:Kelch_3 278 326 1.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000021368
AA Change: Y997F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021368
Gene: ENSMUSG00000020982
AA Change: Y997F

DomainStartEndE-ValueType
Pfam:FbpA 6 523 5.5e-42 PFAM
Pfam:DUF814 530 630 9e-27 PFAM
low complexity region 697 708 N/A INTRINSIC
low complexity region 861 879 N/A INTRINSIC
low complexity region 894 918 N/A INTRINSIC
Pfam:DUF3441 956 1055 9.8e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000021368
AA Change: Y997F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021368
Gene: ENSMUSG00000020982
AA Change: Y997F

DomainStartEndE-ValueType
Pfam:FbpA 6 523 5.5e-42 PFAM
Pfam:DUF814 530 630 9e-27 PFAM
low complexity region 697 708 N/A INTRINSIC
low complexity region 861 879 N/A INTRINSIC
low complexity region 894 918 N/A INTRINSIC
Pfam:DUF3441 956 1055 9.8e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138585
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154667
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221794
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the ribosome quality control complex. The encoded protein facilitates the recognition and ubiquitination of stalled 60S subunits by the ubiquitin ligase listerin. A similar protein in fly functions as a tumor suppressor. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 C T 11: 110,184,044 V1398I probably benign Het
Ackr3 A T 1: 90,214,898 N360Y probably benign Het
Acr T G 15: 89,573,143 M198R probably benign Het
Adamts14 A T 10: 61,218,498 M585K probably benign Het
Adgrb3 A T 1: 25,228,471 C853S probably damaging Het
Arhgef28 G T 13: 97,931,186 S1410R probably benign Het
Armc4 T C 18: 7,286,743 T163A probably benign Het
Asprv1 T A 6: 86,628,372 F67I possibly damaging Het
Atp8b4 T A 2: 126,325,294 Y1095F probably benign Het
Cadps A G 14: 12,449,802 S1136P possibly damaging Het
Ccdc36 A C 9: 108,404,912 S526A possibly damaging Het
Ccdc57 T C 11: 120,897,881 Q380R possibly damaging Het
Cdc45 A T 16: 18,807,340 D142E probably benign Het
Cs A T 10: 128,360,079 N386Y possibly damaging Het
Dsc3 A T 18: 19,986,998 V201E probably damaging Het
Dusp26 G T 8: 31,091,935 R19L probably benign Het
Esyt3 C A 9: 99,358,116 E92* probably null Het
Ext2 T C 2: 93,704,545 N625D probably damaging Het
Fam208b T C 13: 3,590,559 K193E possibly damaging Het
Flvcr2 A T 12: 85,747,155 K102* probably null Het
Fmnl2 T A 2: 53,042,317 S103T possibly damaging Het
Fmo4 T A 1: 162,794,290 I451F probably benign Het
Gak A T 5: 108,585,531 Y47* probably null Het
Gbp10 A T 5: 105,224,300 L198Q probably damaging Het
Gm11559 T A 11: 99,864,929 S135T unknown Het
Gm14496 A T 2: 181,996,153 D340V probably benign Het
Grin2a T C 16: 9,992,395 T47A possibly damaging Het
Gtf2ird1 A T 5: 134,366,936 probably null Het
Herc4 T A 10: 63,245,901 M1K probably null Het
Hirip3 T A 7: 126,862,620 V29E probably damaging Het
Hs3st5 A G 10: 36,832,724 D85G probably benign Het
Htt T A 5: 34,907,199 S2981T probably damaging Het
Il20ra G A 10: 19,759,636 V542I probably damaging Het
Itgb2l C A 16: 96,425,082 C603F probably damaging Het
Klhl41 A C 2: 69,670,802 K202N probably benign Het
Lct G A 1: 128,327,942 S121F possibly damaging Het
Lhx6 C T 2: 36,087,375 G355D probably damaging Het
Limk2 A G 11: 3,358,236 V121A probably benign Het
Med1 T G 11: 98,157,283 K896Q probably damaging Het
Muc6 A G 7: 141,634,458 F2789S probably benign Het
Nrap A G 19: 56,379,158 S296P probably benign Het
Nrxn1 T C 17: 90,588,824 N961D probably damaging Het
Olfr220 T C 1: 174,448,737 V38A probably benign Het
Olfr398 A C 11: 73,983,847 S254A probably benign Het
Olfr777 A T 10: 129,269,243 F27I probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdk4 T A 6: 5,489,166 H247L probably damaging Het
Pkd1l3 T A 8: 109,632,605 V866E probably damaging Het
Pla2g4e G A 2: 120,168,474 P803L probably damaging Het
Pnisr T C 4: 21,860,968 V217A possibly damaging Het
Pole4 G A 6: 82,652,739 P34L unknown Het
Pole4 G T 6: 82,652,740 P34T unknown Het
Ptchd3 G A 11: 121,841,551 W422* probably null Het
Rab1b C T 19: 5,100,485 A167T probably benign Het
Rasal1 T C 5: 120,664,756 M359T probably benign Het
Rexo4 T C 2: 26,960,236 N310D probably benign Het
Rgma C T 7: 73,417,837 T280M probably damaging Het
Rnaset2a A T 17: 8,145,576 I43N probably damaging Het
Rtcb A T 10: 85,942,582 V399E probably damaging Het
Scd4 T G 19: 44,337,574 Y122* probably null Het
Sirt6 T C 10: 81,626,521 I15V possibly damaging Het
Slamf8 A T 1: 172,587,959 V104E possibly damaging Het
Slc12a4 A G 8: 105,951,843 I285T possibly damaging Het
Slc25a13 G A 6: 6,115,104 A207V possibly damaging Het
Slc6a21 T C 7: 45,280,731 S185P probably benign Het
Smarcc2 A C 10: 128,463,871 N135T probably damaging Het
Susd6 T C 12: 80,874,291 S221P probably damaging Het
Syne1 C T 10: 5,040,975 G8418D probably damaging Het
Tbc1d7 C T 13: 43,165,377 V95I probably benign Het
Tcerg1l T C 7: 138,361,866 D225G probably benign Het
Tfip11 A T 5: 112,329,397 I82F possibly damaging Het
Tmem41a C T 16: 21,936,981 G192S probably null Het
Trrap G A 5: 144,853,586 A3619T possibly damaging Het
Tspoap1 G A 11: 87,765,881 probably null Het
Wfdc21 T C 11: 83,747,057 S11P probably benign Het
Zc2hc1b A T 10: 13,168,730 V63E probably damaging Het
Other mutations in Nemf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Nemf APN 12 69344986 splice site probably benign
IGL02499:Nemf APN 12 69322129 missense probably damaging 1.00
IGL03352:Nemf APN 12 69331905 missense probably damaging 1.00
kaempfer UTSW 12 69352336 missense probably benign 0.01
R0335:Nemf UTSW 12 69353803 missense probably benign 0.16
R0538:Nemf UTSW 12 69356314 missense probably damaging 1.00
R0581:Nemf UTSW 12 69322271 missense probably benign
R0909:Nemf UTSW 12 69341610 missense probably damaging 1.00
R1899:Nemf UTSW 12 69346378 missense probably null
R2080:Nemf UTSW 12 69353786 splice site probably benign
R3704:Nemf UTSW 12 69331130 missense probably damaging 1.00
R3842:Nemf UTSW 12 69331949 missense probably damaging 0.98
R4471:Nemf UTSW 12 69314442 missense probably benign 0.04
R4666:Nemf UTSW 12 69312280 missense probably damaging 1.00
R4720:Nemf UTSW 12 69324288 missense probably benign 0.05
R5198:Nemf UTSW 12 69356047 missense probably damaging 1.00
R5474:Nemf UTSW 12 69316335 missense probably benign 0.03
R6893:Nemf UTSW 12 69352336 missense probably benign 0.01
R7008:Nemf UTSW 12 69341621 missense possibly damaging 0.91
R7008:Nemf UTSW 12 69353793 critical splice donor site probably null
R7098:Nemf UTSW 12 69312467 missense probably damaging 1.00
R7154:Nemf UTSW 12 69316741 critical splice donor site probably null
R7452:Nemf UTSW 12 69337959 splice site probably null
R8130:Nemf UTSW 12 69356052 missense possibly damaging 0.91
R8340:Nemf UTSW 12 69353885 missense possibly damaging 0.94
R8914:Nemf UTSW 12 69316315 nonsense probably null
R9089:Nemf UTSW 12 69353854 missense probably damaging 1.00
R9150:Nemf UTSW 12 69341046 missense probably benign 0.00
R9228:Nemf UTSW 12 69341319 missense probably damaging 1.00
R9644:Nemf UTSW 12 69312662 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CAGCTGTAAGGAGAGCACAC -3'
(R):5'- GGGTTCTACTACTCAACAGCAC -3'

Sequencing Primer
(F):5'- GCACACAAGAATGTACTTCTGG -3'
(R):5'- GTTCTACTACTCAACAGCACCCCTC -3'
Posted On 2014-06-23