Incidental Mutation 'R1792:Fam208b'
ID201865
Institutional Source Beutler Lab
Gene Symbol Fam208b
Ensembl Gene ENSMUSG00000033799
Gene Namefamily with sequence similarity 208, member B
SynonymsBC016423
MMRRC Submission 039822-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R1792 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location3566035-3611108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3590559 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 193 (K193E)
Ref Sequence ENSEMBL: ENSMUSP00000093774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096069]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096069
AA Change: K193E

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093774
Gene: ENSMUSG00000033799
AA Change: K193E

DomainStartEndE-ValueType
Pfam:DUF3699 91 167 1.4e-24 PFAM
low complexity region 272 282 N/A INTRINSIC
low complexity region 447 459 N/A INTRINSIC
Pfam:DUF3715 533 695 2.3e-25 PFAM
low complexity region 1156 1168 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 2012 2021 N/A INTRINSIC
low complexity region 2250 2263 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222041
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 C T 11: 110,184,044 V1398I probably benign Het
Ackr3 A T 1: 90,214,898 N360Y probably benign Het
Acr T G 15: 89,573,143 M198R probably benign Het
Adamts14 A T 10: 61,218,498 M585K probably benign Het
Adgrb3 A T 1: 25,228,471 C853S probably damaging Het
Arhgef28 G T 13: 97,931,186 S1410R probably benign Het
Armc4 T C 18: 7,286,743 T163A probably benign Het
Asprv1 T A 6: 86,628,372 F67I possibly damaging Het
Atp8b4 T A 2: 126,325,294 Y1095F probably benign Het
Cadps A G 14: 12,449,802 S1136P possibly damaging Het
Ccdc36 A C 9: 108,404,912 S526A possibly damaging Het
Ccdc57 T C 11: 120,897,881 Q380R possibly damaging Het
Cdc45 A T 16: 18,807,340 D142E probably benign Het
Cs A T 10: 128,360,079 N386Y possibly damaging Het
Dsc3 A T 18: 19,986,998 V201E probably damaging Het
Dusp26 G T 8: 31,091,935 R19L probably benign Het
Esyt3 C A 9: 99,358,116 E92* probably null Het
Ext2 T C 2: 93,704,545 N625D probably damaging Het
Flvcr2 A T 12: 85,747,155 K102* probably null Het
Fmnl2 T A 2: 53,042,317 S103T possibly damaging Het
Fmo4 T A 1: 162,794,290 I451F probably benign Het
Gak A T 5: 108,585,531 Y47* probably null Het
Gbp10 A T 5: 105,224,300 L198Q probably damaging Het
Gm11559 T A 11: 99,864,929 S135T unknown Het
Gm14496 A T 2: 181,996,153 D340V probably benign Het
Grin2a T C 16: 9,992,395 T47A possibly damaging Het
Gtf2ird1 A T 5: 134,366,936 probably null Het
Herc4 T A 10: 63,245,901 M1K probably null Het
Hirip3 T A 7: 126,862,620 V29E probably damaging Het
Hs3st5 A G 10: 36,832,724 D85G probably benign Het
Htt T A 5: 34,907,199 S2981T probably damaging Het
Il20ra G A 10: 19,759,636 V542I probably damaging Het
Itgb2l C A 16: 96,425,082 C603F probably damaging Het
Klhl41 A C 2: 69,670,802 K202N probably benign Het
Lct G A 1: 128,327,942 S121F possibly damaging Het
Lhx6 C T 2: 36,087,375 G355D probably damaging Het
Limk2 A G 11: 3,358,236 V121A probably benign Het
Med1 T G 11: 98,157,283 K896Q probably damaging Het
Muc6 A G 7: 141,634,458 F2789S probably benign Het
Nemf T A 12: 69,312,569 Y997F probably damaging Het
Nrap A G 19: 56,379,158 S296P probably benign Het
Nrxn1 T C 17: 90,588,824 N961D probably damaging Het
Olfr220 T C 1: 174,448,737 V38A probably benign Het
Olfr398 A C 11: 73,983,847 S254A probably benign Het
Olfr777 A T 10: 129,269,243 F27I probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdk4 T A 6: 5,489,166 H247L probably damaging Het
Pkd1l3 T A 8: 109,632,605 V866E probably damaging Het
Pla2g4e G A 2: 120,168,474 P803L probably damaging Het
Pnisr T C 4: 21,860,968 V217A possibly damaging Het
Pole4 G A 6: 82,652,739 P34L unknown Het
Pole4 G T 6: 82,652,740 P34T unknown Het
Ptchd3 G A 11: 121,841,551 W422* probably null Het
Rab1b C T 19: 5,100,485 A167T probably benign Het
Rasal1 T C 5: 120,664,756 M359T probably benign Het
Rexo4 T C 2: 26,960,236 N310D probably benign Het
Rgma C T 7: 73,417,837 T280M probably damaging Het
Rnaset2a A T 17: 8,145,576 I43N probably damaging Het
Rtcb A T 10: 85,942,582 V399E probably damaging Het
Scd4 T G 19: 44,337,574 Y122* probably null Het
Sirt6 T C 10: 81,626,521 I15V possibly damaging Het
Slamf8 A T 1: 172,587,959 V104E possibly damaging Het
Slc12a4 A G 8: 105,951,843 I285T possibly damaging Het
Slc25a13 G A 6: 6,115,104 A207V possibly damaging Het
Slc6a21 T C 7: 45,280,731 S185P probably benign Het
Smarcc2 A C 10: 128,463,871 N135T probably damaging Het
Susd6 T C 12: 80,874,291 S221P probably damaging Het
Syne1 C T 10: 5,040,975 G8418D probably damaging Het
Tbc1d7 C T 13: 43,165,377 V95I probably benign Het
Tcerg1l T C 7: 138,361,866 D225G probably benign Het
Tfip11 A T 5: 112,329,397 I82F possibly damaging Het
Tmem41a C T 16: 21,936,981 G192S probably null Het
Trrap G A 5: 144,853,586 A3619T possibly damaging Het
Tspoap1 G A 11: 87,765,881 probably null Het
Wfdc21 T C 11: 83,747,057 S11P probably benign Het
Zc2hc1b A T 10: 13,168,730 V63E probably damaging Het
Other mutations in Fam208b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Fam208b APN 13 3574832 missense probably benign
IGL00670:Fam208b APN 13 3585241 missense probably benign 0.14
IGL00957:Fam208b APN 13 3577101 missense possibly damaging 0.86
IGL01311:Fam208b APN 13 3575885 missense possibly damaging 0.85
IGL01318:Fam208b APN 13 3575067 missense possibly damaging 0.66
IGL01767:Fam208b APN 13 3576633 missense probably benign 0.00
IGL02073:Fam208b APN 13 3574721 missense probably benign 0.01
IGL02152:Fam208b APN 13 3585371 missense probably benign
IGL02431:Fam208b APN 13 3574736 missense possibly damaging 0.85
IGL02478:Fam208b APN 13 3574661 missense probably benign 0.12
IGL02732:Fam208b APN 13 3573626 missense probably benign 0.09
IGL02745:Fam208b APN 13 3585140 missense probably benign 0.23
IGL02800:Fam208b APN 13 3585154 missense probably benign
IGL02989:Fam208b APN 13 3584820 missense probably benign 0.01
IGL03124:Fam208b APN 13 3574704 missense probably benign 0.41
IGL03154:Fam208b APN 13 3575255 missense possibly damaging 0.56
IGL03216:Fam208b APN 13 3574553 missense probably damaging 0.98
H8562:Fam208b UTSW 13 3577000 missense probably damaging 0.98
PIT4585001:Fam208b UTSW 13 3574979 missense possibly damaging 0.55
R0016:Fam208b UTSW 13 3585170 unclassified probably null
R0016:Fam208b UTSW 13 3585170 unclassified probably null
R0157:Fam208b UTSW 13 3575550 missense probably benign 0.06
R0375:Fam208b UTSW 13 3596842 missense possibly damaging 0.85
R0403:Fam208b UTSW 13 3582052 nonsense probably null
R0472:Fam208b UTSW 13 3588364 missense possibly damaging 0.93
R0517:Fam208b UTSW 13 3566964 missense possibly damaging 0.94
R0586:Fam208b UTSW 13 3590321 missense probably damaging 0.99
R0600:Fam208b UTSW 13 3576054 missense probably benign
R0659:Fam208b UTSW 13 3574448 missense probably damaging 0.99
R1257:Fam208b UTSW 13 3575049 missense probably benign 0.25
R1375:Fam208b UTSW 13 3576029 missense probably benign 0.06
R1443:Fam208b UTSW 13 3575543 missense probably benign 0.00
R1497:Fam208b UTSW 13 3570409 missense probably damaging 0.96
R1544:Fam208b UTSW 13 3590413 missense possibly damaging 0.68
R1554:Fam208b UTSW 13 3576374 missense possibly damaging 0.85
R1629:Fam208b UTSW 13 3574121 missense possibly damaging 0.84
R1633:Fam208b UTSW 13 3581771 missense possibly damaging 0.53
R1661:Fam208b UTSW 13 3573860 missense possibly damaging 0.63
R1673:Fam208b UTSW 13 3584498 critical splice donor site probably null
R1675:Fam208b UTSW 13 3569507 missense possibly damaging 0.65
R1781:Fam208b UTSW 13 3584759 missense possibly damaging 0.95
R1826:Fam208b UTSW 13 3581759 missense probably damaging 0.98
R1920:Fam208b UTSW 13 3576612 missense possibly damaging 0.63
R1983:Fam208b UTSW 13 3574853 missense possibly damaging 0.92
R2016:Fam208b UTSW 13 3576770 missense probably benign 0.41
R2017:Fam208b UTSW 13 3576770 missense probably benign 0.41
R2220:Fam208b UTSW 13 3581872 missense probably benign 0.00
R2513:Fam208b UTSW 13 3582150 missense possibly damaging 0.53
R2898:Fam208b UTSW 13 3585122 missense possibly damaging 0.82
R2904:Fam208b UTSW 13 3582185 missense possibly damaging 0.53
R3149:Fam208b UTSW 13 3574359 missense probably damaging 0.98
R3623:Fam208b UTSW 13 3595556 missense probably benign
R3624:Fam208b UTSW 13 3595556 missense probably benign
R3725:Fam208b UTSW 13 3590538 missense probably benign 0.33
R3835:Fam208b UTSW 13 3575292 missense probably benign 0.01
R3890:Fam208b UTSW 13 3596785 missense probably damaging 0.96
R4023:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4024:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4025:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4050:Fam208b UTSW 13 3573507 missense probably benign 0.09
R4308:Fam208b UTSW 13 3569498 missense probably damaging 0.97
R4484:Fam208b UTSW 13 3581831 missense probably benign 0.12
R4674:Fam208b UTSW 13 3573686 missense possibly damaging 0.69
R4718:Fam208b UTSW 13 3574495 missense probably benign 0.00
R4745:Fam208b UTSW 13 3590069 missense probably benign 0.26
R4776:Fam208b UTSW 13 3570391 missense probably damaging 1.00
R4839:Fam208b UTSW 13 3584807 missense probably damaging 0.96
R4855:Fam208b UTSW 13 3566680 splice site probably null
R5049:Fam208b UTSW 13 3574000 missense probably benign 0.00
R5076:Fam208b UTSW 13 3576357 missense probably benign 0.41
R5287:Fam208b UTSW 13 3575744 missense probably benign 0.41
R5298:Fam208b UTSW 13 3595613 splice site probably null
R5379:Fam208b UTSW 13 3588496 missense probably benign 0.41
R5512:Fam208b UTSW 13 3595517 missense probably damaging 0.99
R5624:Fam208b UTSW 13 3584996 missense possibly damaging 0.66
R5750:Fam208b UTSW 13 3573642 nonsense probably null
R6114:Fam208b UTSW 13 3590081 missense probably damaging 1.00
R6118:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6119:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6269:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6270:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6271:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6272:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6525:Fam208b UTSW 13 3576540 nonsense probably null
R6550:Fam208b UTSW 13 3590519 missense possibly damaging 0.85
R6714:Fam208b UTSW 13 3594189 missense probably benign 0.00
R6797:Fam208b UTSW 13 3576769 missense probably benign 0.26
R6967:Fam208b UTSW 13 3574819 missense probably benign 0.22
R7016:Fam208b UTSW 13 3576857 missense possibly damaging 0.92
R7219:Fam208b UTSW 13 3590521 missense probably damaging 0.99
R7454:Fam208b UTSW 13 3585332 missense probably benign 0.21
R7570:Fam208b UTSW 13 3573621 missense probably damaging 0.99
R7571:Fam208b UTSW 13 3575292 missense probably benign 0.01
R7580:Fam208b UTSW 13 3574752 missense probably damaging 0.99
R7587:Fam208b UTSW 13 3568849 missense possibly damaging 0.83
R7657:Fam208b UTSW 13 3573777 missense probably damaging 0.98
X0024:Fam208b UTSW 13 3599837 missense probably null 0.99
X0025:Fam208b UTSW 13 3576827 missense probably benign 0.15
X0066:Fam208b UTSW 13 3588441 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGAAGGGCACGTTTCAAGCG -3'
(R):5'- CCTGAGGCAGCTATTTTACTCAC -3'

Sequencing Primer
(F):5'- CACGTTTCAAGCGGGGGAG -3'
(R):5'- GTGATATAAATACATGGAGATACGCG -3'
Posted On2014-06-23