Mutagenetix > Incidental Mutation

Incidental Mutation 'R1792:Cadps'

201868

Institutional Source

Beutler Lab

Gene Symbol

Cadps

Ensembl Gene

ENSMUSG00000054423

Gene Name

Ca2+-dependent secretion activator

Synonyms

CAPS1

MMRRC Submission

039822-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1792 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12372563-12823079 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12449802 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1136 (S1136P)

Ref Sequence

ENSEMBL: ENSMUSP00000136076 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067491] [ENSMUST00000112657] [ENSMUST00000112658] [ENSMUST00000177814] [ENSMUST00000224882]

AlphaFold

Q80TJ1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067491
AA Change: S1141P

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000064706
Gene: ENSMUSG00000054423
AA Change: S1141P

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	772	783	N/A	INTRINSIC
DUF1041	833	948	6.21e-54	SMART
low complexity region	1022	1045	N/A	INTRINSIC
low complexity region	1354	1361	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112657
AA Change: S1134P

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000108276
Gene: ENSMUSG00000054423
AA Change: S1134P

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	775	786	N/A	INTRINSIC
DUF1041	836	941	3.88e-55	SMART
low complexity region	1015	1038	N/A	INTRINSIC
low complexity region	1347	1354	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112658
AA Change: S1135P

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000108277
Gene: ENSMUSG00000054423
AA Change: S1135P

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	776	787	N/A	INTRINSIC
DUF1041	837	942	3.88e-55	SMART
low complexity region	1016	1039	N/A	INTRINSIC
low complexity region	1348	1355	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177814
AA Change: S1136P

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000136076
Gene: ENSMUSG00000054423
AA Change: S1136P

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	777	788	N/A	INTRINSIC
DUF1041	838	943	2.75e-55	SMART
low complexity region	1017	1040	N/A	INTRINSIC
low complexity region	1349	1356	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224106

Predicted Effect

unknown
Transcript: ENSMUST00000224581
AA Change: S265P

Predicted Effect

probably benign
Transcript: ENSMUST00000224882

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel neural/endocrine-specific cytosolic and peripheral membrane protein required for the Ca2+-regulated exocytosis of secretory vesicles. The protein acts at a stage in exocytosis that follows ATP-dependent priming, which involves the essential synthesis of phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2). Alternative splicing has been observed at this locus and three variants, encoding distinct isoforms, are described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality, respiratory failure and abnormal adrenal gland physiology. Adult heterozygous null mice display abnormal adrenal gland physiology that is different from that seen in homozygous neonates. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	C	T	11: 110,184,044	V1398I	probably benign	Het
Ackr3	A	T	1: 90,214,898	N360Y	probably benign	Het
Acr	T	G	15: 89,573,143	M198R	probably benign	Het
Adamts14	A	T	10: 61,218,498	M585K	probably benign	Het
Adgrb3	A	T	1: 25,228,471	C853S	probably damaging	Het
Arhgef28	G	T	13: 97,931,186	S1410R	probably benign	Het
Armc4	T	C	18: 7,286,743	T163A	probably benign	Het
Asprv1	T	A	6: 86,628,372	F67I	possibly damaging	Het
Atp8b4	T	A	2: 126,325,294	Y1095F	probably benign	Het
Ccdc36	A	C	9: 108,404,912	S526A	possibly damaging	Het
Ccdc57	T	C	11: 120,897,881	Q380R	possibly damaging	Het
Cdc45	A	T	16: 18,807,340	D142E	probably benign	Het
Cs	A	T	10: 128,360,079	N386Y	possibly damaging	Het
Dsc3	A	T	18: 19,986,998	V201E	probably damaging	Het
Dusp26	G	T	8: 31,091,935	R19L	probably benign	Het
Esyt3	C	A	9: 99,358,116	E92*	probably null	Het
Ext2	T	C	2: 93,704,545	N625D	probably damaging	Het
Fam208b	T	C	13: 3,590,559	K193E	possibly damaging	Het
Flvcr2	A	T	12: 85,747,155	K102*	probably null	Het
Fmnl2	T	A	2: 53,042,317	S103T	possibly damaging	Het
Fmo4	T	A	1: 162,794,290	I451F	probably benign	Het
Gak	A	T	5: 108,585,531	Y47*	probably null	Het
Gbp10	A	T	5: 105,224,300	L198Q	probably damaging	Het
Gm11559	T	A	11: 99,864,929	S135T	unknown	Het
Gm14496	A	T	2: 181,996,153	D340V	probably benign	Het
Grin2a	T	C	16: 9,992,395	T47A	possibly damaging	Het
Gtf2ird1	A	T	5: 134,366,936		probably null	Het
Herc4	T	A	10: 63,245,901	M1K	probably null	Het
Hirip3	T	A	7: 126,862,620	V29E	probably damaging	Het
Hs3st5	A	G	10: 36,832,724	D85G	probably benign	Het
Htt	T	A	5: 34,907,199	S2981T	probably damaging	Het
Il20ra	G	A	10: 19,759,636	V542I	probably damaging	Het
Itgb2l	C	A	16: 96,425,082	C603F	probably damaging	Het
Klhl41	A	C	2: 69,670,802	K202N	probably benign	Het
Lct	G	A	1: 128,327,942	S121F	possibly damaging	Het
Lhx6	C	T	2: 36,087,375	G355D	probably damaging	Het
Limk2	A	G	11: 3,358,236	V121A	probably benign	Het
Med1	T	G	11: 98,157,283	K896Q	probably damaging	Het
Muc6	A	G	7: 141,634,458	F2789S	probably benign	Het
Nemf	T	A	12: 69,312,569	Y997F	probably damaging	Het
Nrap	A	G	19: 56,379,158	S296P	probably benign	Het
Nrxn1	T	C	17: 90,588,824	N961D	probably damaging	Het
Olfr220	T	C	1: 174,448,737	V38A	probably benign	Het
Olfr398	A	C	11: 73,983,847	S254A	probably benign	Het
Olfr777	A	T	10: 129,269,243	F27I	probably benign	Het
Parp14	G	A	16: 35,856,760	A946V	probably benign	Het
Pdk4	T	A	6: 5,489,166	H247L	probably damaging	Het
Pkd1l3	T	A	8: 109,632,605	V866E	probably damaging	Het
Pla2g4e	G	A	2: 120,168,474	P803L	probably damaging	Het
Pnisr	T	C	4: 21,860,968	V217A	possibly damaging	Het
Pole4	G	A	6: 82,652,739	P34L	unknown	Het
Pole4	G	T	6: 82,652,740	P34T	unknown	Het
Ptchd3	G	A	11: 121,841,551	W422*	probably null	Het
Rab1b	C	T	19: 5,100,485	A167T	probably benign	Het
Rasal1	T	C	5: 120,664,756	M359T	probably benign	Het
Rexo4	T	C	2: 26,960,236	N310D	probably benign	Het
Rgma	C	T	7: 73,417,837	T280M	probably damaging	Het
Rnaset2a	A	T	17: 8,145,576	I43N	probably damaging	Het
Rtcb	A	T	10: 85,942,582	V399E	probably damaging	Het
Scd4	T	G	19: 44,337,574	Y122*	probably null	Het
Sirt6	T	C	10: 81,626,521	I15V	possibly damaging	Het
Slamf8	A	T	1: 172,587,959	V104E	possibly damaging	Het
Slc12a4	A	G	8: 105,951,843	I285T	possibly damaging	Het
Slc25a13	G	A	6: 6,115,104	A207V	possibly damaging	Het
Slc6a21	T	C	7: 45,280,731	S185P	probably benign	Het
Smarcc2	A	C	10: 128,463,871	N135T	probably damaging	Het
Susd6	T	C	12: 80,874,291	S221P	probably damaging	Het
Syne1	C	T	10: 5,040,975	G8418D	probably damaging	Het
Tbc1d7	C	T	13: 43,165,377	V95I	probably benign	Het
Tcerg1l	T	C	7: 138,361,866	D225G	probably benign	Het
Tfip11	A	T	5: 112,329,397	I82F	possibly damaging	Het
Tmem41a	C	T	16: 21,936,981	G192S	probably null	Het
Trrap	G	A	5: 144,853,586	A3619T	possibly damaging	Het
Tspoap1	G	A	11: 87,765,881		probably null	Het
Wfdc21	T	C	11: 83,747,057	S11P	probably benign	Het
Zc2hc1b	A	T	10: 13,168,730	V63E	probably damaging	Het

Other mutations in Cadps

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00926:Cadps	APN	14	12491795	missense	probably damaging	1.00
IGL00990:Cadps	APN	14	12715374	missense	possibly damaging	0.56
IGL01071:Cadps	APN	14	12509091	splice site	probably null
IGL01339:Cadps	APN	14	12486543	missense	possibly damaging	0.58
IGL01518:Cadps	APN	14	12522352	missense	probably damaging	1.00
IGL01560:Cadps	APN	14	12491792	missense	probably damaging	1.00
IGL01598:Cadps	APN	14	12522202	critical splice donor site	probably null
IGL01603:Cadps	APN	14	12454154	splice site	probably benign
IGL01836:Cadps	APN	14	12522311	missense	probably damaging	1.00
IGL01839:Cadps	APN	14	12467184	splice site	probably benign
IGL01932:Cadps	APN	14	12373609	utr 3 prime	probably benign
IGL02172:Cadps	APN	14	12705681	missense	probably damaging	1.00
IGL02175:Cadps	APN	14	12467092	missense	probably damaging	0.96
IGL02212:Cadps	APN	14	12522345	missense	possibly damaging	0.94
IGL02351:Cadps	APN	14	12597380	missense	probably damaging	0.99
IGL02358:Cadps	APN	14	12597380	missense	probably damaging	0.99
IGL02499:Cadps	APN	14	12822725	nonsense	probably null
IGL02505:Cadps	APN	14	12449759	missense	probably damaging	1.00
IGL02591:Cadps	APN	14	12473465	missense	probably damaging	1.00
IGL02592:Cadps	APN	14	12473465	missense	probably damaging	1.00
IGL02671:Cadps	APN	14	12491824	missense	probably damaging	1.00
IGL02956:Cadps	APN	14	12418047	splice site	probably benign
IGL03029:Cadps	APN	14	12376675	missense	probably damaging	1.00
IGL03216:Cadps	APN	14	12439944	missense	probably damaging	1.00
IGL03282:Cadps	APN	14	12465856	splice site	probably benign
turbo	UTSW	14	12491800	missense	probably damaging	1.00
R0241:Cadps	UTSW	14	12376675	missense	probably damaging	1.00
R0241:Cadps	UTSW	14	12376675	missense	probably damaging	1.00
R0420:Cadps	UTSW	14	12491800	missense	probably damaging	1.00
R1180:Cadps	UTSW	14	12457836	splice site	probably benign
R1398:Cadps	UTSW	14	12449822	missense	probably damaging	1.00
R1678:Cadps	UTSW	14	12517802	critical splice donor site	probably null
R1863:Cadps	UTSW	14	12449802	missense	possibly damaging	0.93
R1863:Cadps	UTSW	14	12505796	missense	probably benign	0.09
R1918:Cadps	UTSW	14	12546372	missense	probably damaging	0.99
R1920:Cadps	UTSW	14	12465859	missense	possibly damaging	0.64
R1921:Cadps	UTSW	14	12465859	missense	possibly damaging	0.64
R1922:Cadps	UTSW	14	12465859	missense	possibly damaging	0.64
R1925:Cadps	UTSW	14	12705726	missense	probably damaging	1.00
R1966:Cadps	UTSW	14	12822450	nonsense	probably null
R2013:Cadps	UTSW	14	12522337	missense	probably damaging	1.00
R2228:Cadps	UTSW	14	12465935	missense	probably benign	0.05
R2331:Cadps	UTSW	14	12603692	missense	probably damaging	1.00
R3436:Cadps	UTSW	14	12616158	splice site	probably null
R3853:Cadps	UTSW	14	12509090	splice site	probably benign
R3893:Cadps	UTSW	14	12488883	utr 3 prime	probably benign
R3916:Cadps	UTSW	14	12457702	missense	probably benign	0.00
R3917:Cadps	UTSW	14	12457702	missense	probably benign	0.00
R3953:Cadps	UTSW	14	12505937	missense	probably damaging	1.00
R3966:Cadps	UTSW	14	12522161	splice site	probably null
R4024:Cadps	UTSW	14	12705539	missense	probably damaging	1.00
R4079:Cadps	UTSW	14	12457702	missense	probably benign	0.00
R4230:Cadps	UTSW	14	12488987	missense	probably damaging	0.98
R4333:Cadps	UTSW	14	12467031	missense	probably damaging	1.00
R4410:Cadps	UTSW	14	12822323	missense	probably damaging	0.98
R4586:Cadps	UTSW	14	12505808	missense	probably damaging	1.00
R4685:Cadps	UTSW	14	12467139	missense	possibly damaging	0.77
R4698:Cadps	UTSW	14	12705654	missense	possibly damaging	0.90
R4855:Cadps	UTSW	14	12822449	missense	unknown
R4898:Cadps	UTSW	14	12411588	missense	possibly damaging	0.86
R4908:Cadps	UTSW	14	12536386	missense	probably damaging	1.00
R5208:Cadps	UTSW	14	12457711	missense	possibly damaging	0.68
R5297:Cadps	UTSW	14	12822345	missense	probably damaging	1.00
R5328:Cadps	UTSW	14	12457790	missense	probably benign	0.31
R5408:Cadps	UTSW	14	12705759	missense	possibly damaging	0.87
R5529:Cadps	UTSW	14	12454285	missense	probably damaging	1.00
R5567:Cadps	UTSW	14	12473497	missense	possibly damaging	0.49
R5570:Cadps	UTSW	14	12473497	missense	possibly damaging	0.49
R5727:Cadps	UTSW	14	12486525	nonsense	probably null
R5812:Cadps	UTSW	14	12376685	missense	probably benign
R6361:Cadps	UTSW	14	12491778	nonsense	probably null
R6767:Cadps	UTSW	14	12550888	missense	probably damaging	1.00
R6805:Cadps	UTSW	14	12467103	missense	probably damaging	0.99
R6861:Cadps	UTSW	14	12522401	nonsense	probably null
R6883:Cadps	UTSW	14	12465883	missense	probably damaging	0.96
R6887:Cadps	UTSW	14	12505811	missense	probably damaging	1.00
R6997:Cadps	UTSW	14	12505793	missense	possibly damaging	0.88
R7102:Cadps	UTSW	14	12603738	missense	probably damaging	1.00
R7120:Cadps	UTSW	14	12439919	missense	probably damaging	0.98
R7143:Cadps	UTSW	14	12491838	missense	probably benign	0.02
R7290:Cadps	UTSW	14	12616099	missense	probably damaging	1.00
R7614:Cadps	UTSW	14	12454260	missense	probably damaging	1.00
R7674:Cadps	UTSW	14	12411581	missense	probably damaging	0.99
R7715:Cadps	UTSW	14	12457762	missense	probably benign	0.01
R7801:Cadps	UTSW	14	12489476	critical splice donor site	probably null
R7814:Cadps	UTSW	14	12376706	missense	probably damaging	0.99
R7915:Cadps	UTSW	14	12705544	missense	possibly damaging	0.84
R8087:Cadps	UTSW	14	12536380	missense	probably damaging	1.00
R8109:Cadps	UTSW	14	12488975	missense	probably benign	0.00
R8485:Cadps	UTSW	14	12439872	missense	probably damaging	1.00
R9156:Cadps	UTSW	14	12705676	missense	probably damaging	1.00
R9158:Cadps	UTSW	14	12546356	missense	probably benign	0.10
R9312:Cadps	UTSW	14	12616095	missense	probably damaging	1.00
R9465:Cadps	UTSW	14	12489002	missense	possibly damaging	0.93
R9519:Cadps	UTSW	14	12546290	missense	possibly damaging	0.86
R9649:Cadps	UTSW	14	12597418	missense	probably damaging	0.99
R9662:Cadps	UTSW	14	12411567	missense	probably benign	0.02
R9674:Cadps	UTSW	14	12454291	missense	probably damaging	1.00
X0018:Cadps	UTSW	14	12373690	missense	probably damaging	1.00
X0028:Cadps	UTSW	14	12467118	missense	possibly damaging	0.93
Z1088:Cadps	UTSW	14	12467113	missense	probably damaging	0.96
Z1177:Cadps	UTSW	14	12465880	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACTAGCAGACTTGGGAAGAAATTTG -3'
(R):5'- AGCCCTTCTAAGAAAGGGAAAGTC -3'

Sequencing Primer
(F):5'- CTTGGGAAGAAATTTGTGAAGTTTTC -3'
(R):5'- CCTTCTAAGAAAGGGAAAGTCACTTG -3'

Posted On

2014-06-23