Mutagenetix > Incidental Mutation

Incidental Mutation 'R1792:Grin2a'

201870

Institutional Source

Beutler Lab

Gene Symbol

Grin2a

Ensembl Gene

ENSMUSG00000059003

Gene Name

glutamate receptor, ionotropic, NMDA2A (epsilon 1)

Synonyms

NR2A, GluRepsilon1, NMDAR2A, GluN2A

MMRRC Submission

039822-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.405) question?

Stock #

R1792 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

9567898-9995560 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 9992395 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 47 (T47A)

Ref Sequence

ENSEMBL: ENSMUSP00000142900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032331] [ENSMUST00000115835] [ENSMUST00000199708]

AlphaFold

P35436

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032331
AA Change: T47A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000032331
Gene: ENSMUSG00000059003
AA Change: T47A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	106	301	1.6e-10	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	2.1e-230	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115835
AA Change: T47A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000111501
Gene: ENSMUSG00000059003
AA Change: T47A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	99	300	9.2e-11	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	1.2e-266	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156482

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197242

Predicted Effect

possibly damaging
Transcript: ENSMUST00000199708
AA Change: T47A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000142900
Gene: ENSMUSG00000059003
AA Change: T47A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	106	301	1.6e-10	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	2.1e-230	PFAM

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.2%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutamate-gated ion channel protein family. The encoded protein is an N-methyl-D-aspartate (NMDA) receptor subunit. NMDA receptors are both ligand-gated and voltage-dependent, and are involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. These receptors are permeable to calcium ions, and activation results in a calcium influx into post-synaptic cells, which results in the activation of several signaling cascades. Disruption of this gene is associated with focal epilepsy and speech disorder with or without mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit jumpiness, mildly impaired long-term potentiation and spatial learning, increased locomotor activity and metabolism of dopamine and serotonin, and loss of analgesic tolerance after repeated morphine doses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	C	T	11: 110,184,044	V1398I	probably benign	Het
Ackr3	A	T	1: 90,214,898	N360Y	probably benign	Het
Acr	T	G	15: 89,573,143	M198R	probably benign	Het
Adamts14	A	T	10: 61,218,498	M585K	probably benign	Het
Adgrb3	A	T	1: 25,228,471	C853S	probably damaging	Het
Arhgef28	G	T	13: 97,931,186	S1410R	probably benign	Het
Armc4	T	C	18: 7,286,743	T163A	probably benign	Het
Asprv1	T	A	6: 86,628,372	F67I	possibly damaging	Het
Atp8b4	T	A	2: 126,325,294	Y1095F	probably benign	Het
Cadps	A	G	14: 12,449,802	S1136P	possibly damaging	Het
Ccdc36	A	C	9: 108,404,912	S526A	possibly damaging	Het
Ccdc57	T	C	11: 120,897,881	Q380R	possibly damaging	Het
Cdc45	A	T	16: 18,807,340	D142E	probably benign	Het
Cs	A	T	10: 128,360,079	N386Y	possibly damaging	Het
Dsc3	A	T	18: 19,986,998	V201E	probably damaging	Het
Dusp26	G	T	8: 31,091,935	R19L	probably benign	Het
Esyt3	C	A	9: 99,358,116	E92*	probably null	Het
Ext2	T	C	2: 93,704,545	N625D	probably damaging	Het
Fam208b	T	C	13: 3,590,559	K193E	possibly damaging	Het
Flvcr2	A	T	12: 85,747,155	K102*	probably null	Het
Fmnl2	T	A	2: 53,042,317	S103T	possibly damaging	Het
Fmo4	T	A	1: 162,794,290	I451F	probably benign	Het
Gak	A	T	5: 108,585,531	Y47*	probably null	Het
Gbp10	A	T	5: 105,224,300	L198Q	probably damaging	Het
Gm11559	T	A	11: 99,864,929	S135T	unknown	Het
Gm14496	A	T	2: 181,996,153	D340V	probably benign	Het
Gtf2ird1	A	T	5: 134,366,936		probably null	Het
Herc4	T	A	10: 63,245,901	M1K	probably null	Het
Hirip3	T	A	7: 126,862,620	V29E	probably damaging	Het
Hs3st5	A	G	10: 36,832,724	D85G	probably benign	Het
Htt	T	A	5: 34,907,199	S2981T	probably damaging	Het
Il20ra	G	A	10: 19,759,636	V542I	probably damaging	Het
Itgb2l	C	A	16: 96,425,082	C603F	probably damaging	Het
Klhl41	A	C	2: 69,670,802	K202N	probably benign	Het
Lct	G	A	1: 128,327,942	S121F	possibly damaging	Het
Lhx6	C	T	2: 36,087,375	G355D	probably damaging	Het
Limk2	A	G	11: 3,358,236	V121A	probably benign	Het
Med1	T	G	11: 98,157,283	K896Q	probably damaging	Het
Muc6	A	G	7: 141,634,458	F2789S	probably benign	Het
Nemf	T	A	12: 69,312,569	Y997F	probably damaging	Het
Nrap	A	G	19: 56,379,158	S296P	probably benign	Het
Nrxn1	T	C	17: 90,588,824	N961D	probably damaging	Het
Olfr220	T	C	1: 174,448,737	V38A	probably benign	Het
Olfr398	A	C	11: 73,983,847	S254A	probably benign	Het
Olfr777	A	T	10: 129,269,243	F27I	probably benign	Het
Parp14	G	A	16: 35,856,760	A946V	probably benign	Het
Pdk4	T	A	6: 5,489,166	H247L	probably damaging	Het
Pkd1l3	T	A	8: 109,632,605	V866E	probably damaging	Het
Pla2g4e	G	A	2: 120,168,474	P803L	probably damaging	Het
Pnisr	T	C	4: 21,860,968	V217A	possibly damaging	Het
Pole4	G	A	6: 82,652,739	P34L	unknown	Het
Pole4	G	T	6: 82,652,740	P34T	unknown	Het
Ptchd3	G	A	11: 121,841,551	W422*	probably null	Het
Rab1b	C	T	19: 5,100,485	A167T	probably benign	Het
Rasal1	T	C	5: 120,664,756	M359T	probably benign	Het
Rexo4	T	C	2: 26,960,236	N310D	probably benign	Het
Rgma	C	T	7: 73,417,837	T280M	probably damaging	Het
Rnaset2a	A	T	17: 8,145,576	I43N	probably damaging	Het
Rtcb	A	T	10: 85,942,582	V399E	probably damaging	Het
Scd4	T	G	19: 44,337,574	Y122*	probably null	Het
Sirt6	T	C	10: 81,626,521	I15V	possibly damaging	Het
Slamf8	A	T	1: 172,587,959	V104E	possibly damaging	Het
Slc12a4	A	G	8: 105,951,843	I285T	possibly damaging	Het
Slc25a13	G	A	6: 6,115,104	A207V	possibly damaging	Het
Slc6a21	T	C	7: 45,280,731	S185P	probably benign	Het
Smarcc2	A	C	10: 128,463,871	N135T	probably damaging	Het
Susd6	T	C	12: 80,874,291	S221P	probably damaging	Het
Syne1	C	T	10: 5,040,975	G8418D	probably damaging	Het
Tbc1d7	C	T	13: 43,165,377	V95I	probably benign	Het
Tcerg1l	T	C	7: 138,361,866	D225G	probably benign	Het
Tfip11	A	T	5: 112,329,397	I82F	possibly damaging	Het
Tmem41a	C	T	16: 21,936,981	G192S	probably null	Het
Trrap	G	A	5: 144,853,586	A3619T	possibly damaging	Het
Tspoap1	G	A	11: 87,765,881		probably null	Het
Wfdc21	T	C	11: 83,747,057	S11P	probably benign	Het
Zc2hc1b	A	T	10: 13,168,730	V63E	probably damaging	Het

Other mutations in Grin2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01777:Grin2a	APN	16	9644130	missense	probably benign	0.29
IGL03288:Grin2a	APN	16	9669840	missense	possibly damaging	0.85
IGL02796:Grin2a	UTSW	16	9585108	missense	possibly damaging	0.72
PIT4402001:Grin2a	UTSW	16	9644199	missense	possibly damaging	0.77
PIT4494001:Grin2a	UTSW	16	9585096	missense	probably damaging	0.98
R0055:Grin2a	UTSW	16	9669807	missense	probably damaging	0.99
R0055:Grin2a	UTSW	16	9669807	missense	probably damaging	0.99
R0164:Grin2a	UTSW	16	9994821	critical splice donor site	probably null
R0164:Grin2a	UTSW	16	9994821	critical splice donor site	probably null
R0211:Grin2a	UTSW	16	9579173	missense	possibly damaging	0.86
R0390:Grin2a	UTSW	16	9579585	missense	possibly damaging	0.85
R0659:Grin2a	UTSW	16	9992472	missense	probably damaging	0.98
R0661:Grin2a	UTSW	16	9992472	missense	probably damaging	0.98
R0734:Grin2a	UTSW	16	9579611	missense	possibly damaging	0.71
R1524:Grin2a	UTSW	16	9663603	missense	possibly damaging	0.55
R1542:Grin2a	UTSW	16	9579203	missense	probably damaging	0.98
R1556:Grin2a	UTSW	16	9707715	missense	probably benign	0.18
R1605:Grin2a	UTSW	16	9663330	missense	possibly damaging	0.46
R2024:Grin2a	UTSW	16	9644243	missense	possibly damaging	0.76
R2057:Grin2a	UTSW	16	9669744	missense	probably benign	0.14
R2344:Grin2a	UTSW	16	9663235	missense	probably benign	0.03
R2847:Grin2a	UTSW	16	9761965	missense	possibly damaging	0.73
R2848:Grin2a	UTSW	16	9761965	missense	possibly damaging	0.73
R2981:Grin2a	UTSW	16	9644223	missense	possibly damaging	0.89
R4197:Grin2a	UTSW	16	9761967	missense	probably damaging	1.00
R4342:Grin2a	UTSW	16	9653589	missense	possibly damaging	0.52
R4741:Grin2a	UTSW	16	9663512	missense	probably damaging	1.00
R4891:Grin2a	UTSW	16	9657706	missense	possibly damaging	0.51
R4925:Grin2a	UTSW	16	9669823	missense	probably damaging	0.98
R5563:Grin2a	UTSW	16	9707717	missense	probably benign	0.18
R5645:Grin2a	UTSW	16	9992226	missense	probably damaging	0.98
R5769:Grin2a	UTSW	16	9761526	missense	possibly damaging	0.89
R5885:Grin2a	UTSW	16	9761905	missense	possibly damaging	0.95
R6065:Grin2a	UTSW	16	9761907	missense	possibly damaging	0.92
R6083:Grin2a	UTSW	16	9579540	missense	probably benign	0.02
R6137:Grin2a	UTSW	16	9653449	missense	probably benign	0.32
R6286:Grin2a	UTSW	16	9761775	missense	possibly damaging	0.93
R6342:Grin2a	UTSW	16	9579334	missense	probably damaging	0.98
R6697:Grin2a	UTSW	16	9669840	missense	possibly damaging	0.85
R6924:Grin2a	UTSW	16	9663228	missense	possibly damaging	0.71
R7070:Grin2a	UTSW	16	9579424	missense	possibly damaging	0.92
R7235:Grin2a	UTSW	16	9579265	missense	probably damaging	0.98
R7274:Grin2a	UTSW	16	9579122	missense	possibly damaging	0.71
R7669:Grin2a	UTSW	16	9992463	missense	probably benign
R7990:Grin2a	UTSW	16	9579176	missense	possibly damaging	0.71
R8261:Grin2a	UTSW	16	9663518	missense	probably damaging	0.97
R8503:Grin2a	UTSW	16	9663549	missense	probably damaging	0.97
R8679:Grin2a	UTSW	16	9585225	missense	possibly damaging	0.90
R8700:Grin2a	UTSW	16	9579548	missense	probably benign	0.32
R8823:Grin2a	UTSW	16	9669894	missense	possibly damaging	0.96
R9122:Grin2a	UTSW	16	9579322	missense	possibly damaging	0.93
R9656:Grin2a	UTSW	16	9579607	missense	possibly damaging	0.71
R9674:Grin2a	UTSW	16	9653401	nonsense	probably null
R9786:Grin2a	UTSW	16	9653602	missense	possibly damaging	0.71
X0024:Grin2a	UTSW	16	9663199	missense	probably benign	0.36
Z1177:Grin2a	UTSW	16	9663577	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- GGTCCGTATCATCTCCAAACAC -3'
(R):5'- GGGCAGTCTATCCTGTTTCCTG -3'

Sequencing Primer
(F):5'- TATCATCTCCAAACACCAAGCCATG -3'
(R):5'- GACCACCACCTGCCTCTCG -3'

Posted On

2014-06-23