Incidental Mutation 'R1793:Hmcn1'
ID 201890
Institutional Source Beutler Lab
Gene Symbol Hmcn1
Ensembl Gene ENSMUSG00000066842
Gene Name hemicentin 1
Synonyms LOC240793, EG545370
MMRRC Submission 039823-MU
Accession Numbers

Ncbi RefSeq: NM_001024720.3; MGI:2685047

Essential gene? Non essential (E-score: 0.000) question?
Stock # R1793 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 150562524-150993435 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 150749083 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 1024 (S1024G)
Ref Sequence ENSEMBL: ENSMUSP00000121500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074783] [ENSMUST00000137197]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000074783
AA Change: S1024G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074340
Gene: ENSMUSG00000066842
AA Change: S1024G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
Pfam:G2F 4869 5051 1.5e-57 PFAM
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5354 4.32e-10 SMART
low complexity region 5384 5400 N/A INTRINSIC
low complexity region 5401 5412 N/A INTRINSIC
EGF_CA 5431 5470 2.78e-13 SMART
EGF 5474 5516 1.44e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137197
AA Change: S1024G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000121500
Gene: ENSMUSG00000066842
AA Change: S1024G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
PDB:1GL4|A 4869 5082 3e-6 PDB
SCOP:d1gl4a1 4869 5082 3e-79 SMART
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5353 2.78e-13 SMART
EGF 5357 5399 1.44e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177268
Meta Mutation Damage Score 0.0760 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency 100% (122/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large extracellular member of the immunoglobulin superfamily. A similar protein in C. elegans forms long, fine tracks at specific extracellular sites that are involved in many processes such as stabilization of the germline syncytium, anchorage of mechanosensory neurons to the epidermis, and organization of hemidesmosomes in the epidermis. Mutations in this gene may be associated with age-related macular degeneration. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,278 (GRCm38) H571Q probably damaging Het
Abcf2 T A 5: 24,568,776 (GRCm38) M372L probably benign Het
Acaca A G 11: 84,338,393 (GRCm38) D1682G probably damaging Het
Acaca A C 11: 84,315,969 (GRCm38) T1552P probably damaging Het
Acvr1b T C 15: 101,194,025 (GRCm38) V62A probably benign Het
Aimp1 C T 3: 132,674,064 (GRCm38) V97M probably benign Het
Aldh1l1 C T 6: 90,577,831 (GRCm38) T557I possibly damaging Het
Alpk1 T C 3: 127,677,798 (GRCm38) T1012A probably damaging Het
Amot G A X: 145,450,589 (GRCm38) probably benign Het
Arap1 T A 7: 101,388,622 (GRCm38) H477Q probably benign Het
Arhgap18 T A 10: 26,860,736 (GRCm38) probably benign Het
Arhgef10l C T 4: 140,515,373 (GRCm38) V862M probably damaging Het
Arl4d A G 11: 101,666,728 (GRCm38) I27V probably benign Het
Asb18 G A 1: 90,014,555 (GRCm38) P8L probably damaging Het
Ash1l A G 3: 89,070,309 (GRCm38) H2682R probably damaging Het
Aspm T A 1: 139,457,341 (GRCm38) V241E probably benign Het
Atf7ip G T 6: 136,609,219 (GRCm38) probably benign Het
AY358078 T G 14: 51,804,594 (GRCm38) M142R unknown Het
C3 T A 17: 57,219,592 (GRCm38) K796N possibly damaging Het
Cd3eap T C 7: 19,357,979 (GRCm38) T68A possibly damaging Het
Ceacam16 T C 7: 19,856,116 (GRCm38) T301A probably damaging Het
Ceacam5 T G 7: 17,747,395 (GRCm38) Y356D probably benign Het
Cep192 C T 18: 67,851,767 (GRCm38) A1616V possibly damaging Het
Cherp A T 8: 72,463,150 (GRCm38) H645Q probably benign Het
CK137956 T C 4: 127,951,449 (GRCm38) D167G probably benign Het
Clcn1 T A 6: 42,298,926 (GRCm38) probably null Het
Cntn1 C T 15: 92,291,671 (GRCm38) T625I possibly damaging Het
Cpn2 T A 16: 30,259,324 (GRCm38) N520Y probably damaging Het
Crocc G A 4: 141,019,309 (GRCm38) R1762W probably damaging Het
Cts3 C A 13: 61,568,153 (GRCm38) V100F probably benign Het
Ddx56 A T 11: 6,266,934 (GRCm38) V87D probably damaging Het
Dnah9 C T 11: 66,119,594 (GRCm38) probably null Het
Dock1 T A 7: 135,098,727 (GRCm38) probably null Het
Dst T A 1: 34,152,471 (GRCm38) Y291* probably null Het
Eif4g3 T C 4: 138,171,131 (GRCm38) I1071T probably damaging Het
Fblim1 T C 4: 141,595,238 (GRCm38) Q78R probably damaging Het
Fcamr C T 1: 130,811,547 (GRCm38) P195S probably benign Het
Fcho1 G A 8: 71,709,022 (GRCm38) Q835* probably null Het
Frem3 A G 8: 80,613,112 (GRCm38) N678S probably benign Het
Frk G A 10: 34,607,882 (GRCm38) R413H probably benign Het
Gm10619 C A 7: 73,810,010 (GRCm38) noncoding transcript Het
Gm12185 G A 11: 48,915,756 (GRCm38) R203* probably null Het
Gm12886 A G 4: 121,422,977 (GRCm38) V34A probably benign Het
Gna12 A T 5: 140,760,952 (GRCm38) I246N probably damaging Het
Gpm6a T C 8: 55,054,832 (GRCm38) M201T probably benign Het
Gpsm2 T G 3: 108,700,909 (GRCm38) D220A probably benign Het
Grip2 C G 6: 91,783,642 (GRCm38) V325L probably benign Het
Grk5 C A 19: 61,076,762 (GRCm38) A288D probably damaging Het
Herpud2 G A 9: 25,110,657 (GRCm38) A231V possibly damaging Het
Hp1bp3 A G 4: 138,230,509 (GRCm38) D295G probably damaging Het
Igsf21 T C 4: 140,034,392 (GRCm38) H325R probably damaging Het
Ing2 T A 8: 47,669,329 (GRCm38) L61F probably damaging Het
Jak3 T C 8: 71,685,946 (GRCm38) probably benign Het
Kcnn3 T A 3: 89,609,405 (GRCm38) C374S probably benign Het
Klk1b22 A G 7: 44,116,351 (GRCm38) probably benign Het
Larp1 T C 11: 58,049,938 (GRCm38) M630T possibly damaging Het
Lhx5 T A 5: 120,434,660 (GRCm38) C115S probably damaging Het
Lmcd1 C A 6: 112,328,751 (GRCm38) T271K probably benign Het
Lpar1 G A 4: 58,486,798 (GRCm38) R158* probably null Het
Lyst T A 13: 13,647,083 (GRCm38) C1347* probably null Het
Maats1 T A 16: 38,321,419 (GRCm38) N384Y possibly damaging Het
Map3k8 G A 18: 4,332,389 (GRCm38) Q441* probably null Het
Mboat1 T C 13: 30,219,650 (GRCm38) V144A probably damaging Het
Mcur1 C T 13: 43,560,015 (GRCm38) G38S unknown Het
Med13 T A 11: 86,329,351 (GRCm38) M276L probably benign Het
Mefv A G 16: 3,708,664 (GRCm38) S699P possibly damaging Het
Mfsd4a C A 1: 132,059,339 (GRCm38) A62S probably damaging Het
Mmp27 A G 9: 7,571,458 (GRCm38) M1V probably null Het
Myo1c C T 11: 75,657,589 (GRCm38) T58I probably damaging Het
Myom3 A T 4: 135,810,755 (GRCm38) D1316V probably benign Het
Naa25 C A 5: 121,420,593 (GRCm38) R333S probably damaging Het
Naa25 T A 5: 121,417,415 (GRCm38) C235S possibly damaging Het
Nav3 G A 10: 109,703,372 (GRCm38) T2056I probably benign Het
Nol4 A G 18: 22,769,821 (GRCm38) Y378H probably damaging Het
Npat G A 9: 53,552,289 (GRCm38) R124Q probably damaging Het
Npr3 T A 15: 11,848,579 (GRCm38) E434V probably benign Het
Nptx2 A G 5: 144,548,320 (GRCm38) T208A probably benign Het
Obscn C T 11: 59,077,780 (GRCm38) V2798M probably damaging Het
Olfr1406 A T 1: 173,184,409 (GRCm38) H8Q probably benign Het
Olfr1484 C T 19: 13,585,415 (GRCm38) T37I probably benign Het
Olfr569 A G 7: 102,888,043 (GRCm38) Y37H probably benign Het
Padi1 G A 4: 140,814,656 (GRCm38) P652S probably damaging Het
Pcdh1 G T 18: 38,198,885 (GRCm38) P355Q probably damaging Het
Pck2 G A 14: 55,543,965 (GRCm38) R189H possibly damaging Het
Pcsk5 T A 19: 17,454,750 (GRCm38) K1500N possibly damaging Het
Phc3 A T 3: 30,948,716 (GRCm38) S218T probably damaging Het
Piezo2 T A 18: 63,106,284 (GRCm38) M510L possibly damaging Het
Ppp1r3a A T 6: 14,754,718 (GRCm38) Y177N probably damaging Het
Psme2b A T 11: 48,945,534 (GRCm38) D195E probably damaging Het
Ptprr T C 10: 116,252,922 (GRCm38) V463A probably damaging Het
Pwwp2b G A 7: 139,256,365 (GRCm38) R574Q probably damaging Het
Rap1gds1 T A 3: 139,050,553 (GRCm38) T14S possibly damaging Het
Rbm11 A T 16: 75,600,797 (GRCm38) K205M probably damaging Het
Rfx1 T A 8: 84,066,421 (GRCm38) probably benign Het
Rnasel C A 1: 153,754,423 (GRCm38) H228Q probably damaging Het
Sap130 T A 18: 31,698,587 (GRCm38) I710K probably benign Het
Slc27a4 C A 2: 29,805,721 (GRCm38) D89E probably benign Het
Spata31d1b T C 13: 59,715,965 (GRCm38) V309A probably benign Het
Syt7 T G 19: 10,443,990 (GRCm38) Y420D probably damaging Het
Tanc2 A G 11: 105,625,033 (GRCm38) probably null Het
Tbc1d10b A G 7: 127,203,758 (GRCm38) S333P possibly damaging Het
Tenm2 G A 11: 36,023,382 (GRCm38) P2442S probably damaging Het
Tenm3 C T 8: 48,674,544 (GRCm38) C33Y probably damaging Het
Timmdc1 A G 16: 38,499,057 (GRCm38) L245P possibly damaging Het
Tlr5 T C 1: 182,972,447 (GRCm38) F5L probably benign Het
Ttc25 C A 11: 100,569,853 (GRCm38) probably null Het
Ttll4 T A 1: 74,687,840 (GRCm38) F784L possibly damaging Het
Tulp4 A G 17: 6,139,112 (GRCm38) T70A possibly damaging Het
Txndc17 T A 11: 72,208,745 (GRCm38) N81K probably benign Het
Ubr3 C T 2: 70,000,551 (GRCm38) probably benign Het
Uri1 A C 7: 37,981,691 (GRCm38) V96G probably damaging Het
Uspl1 T A 5: 149,213,436 (GRCm38) I482N probably damaging Het
Vmn1r229 A G 17: 20,814,712 (GRCm38) N73S possibly damaging Het
Vwa7 G T 17: 35,024,412 (GRCm38) G689* probably null Het
Zfp114 T A 7: 24,177,739 (GRCm38) probably null Het
Zfp618 A G 4: 63,133,237 (GRCm38) S659G probably damaging Het
Zfp872 A G 9: 22,200,053 (GRCm38) K275R probably damaging Het
Zzef1 C T 11: 72,886,709 (GRCm38) P1789S probably damaging Het
Other mutations in Hmcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Hmcn1 APN 1 150,677,278 (GRCm38) missense probably benign
IGL00571:Hmcn1 APN 1 150,638,999 (GRCm38) missense probably benign 0.05
IGL00726:Hmcn1 APN 1 150,806,366 (GRCm38) critical splice donor site probably null
IGL00802:Hmcn1 APN 1 150,664,936 (GRCm38) missense probably benign 0.19
IGL00824:Hmcn1 APN 1 150,656,734 (GRCm38) missense probably damaging 1.00
IGL00834:Hmcn1 APN 1 150,630,340 (GRCm38) missense probably benign 0.00
IGL00843:Hmcn1 APN 1 150,610,713 (GRCm38) missense possibly damaging 0.95
IGL00845:Hmcn1 APN 1 150,605,006 (GRCm38) missense probably damaging 0.98
IGL00851:Hmcn1 APN 1 150,582,301 (GRCm38) missense probably benign 0.02
IGL00909:Hmcn1 APN 1 150,638,869 (GRCm38) missense probably benign 0.12
IGL01074:Hmcn1 APN 1 150,627,033 (GRCm38) missense possibly damaging 0.82
IGL01112:Hmcn1 APN 1 150,632,552 (GRCm38) splice site probably benign
IGL01304:Hmcn1 APN 1 150,622,924 (GRCm38) missense probably damaging 0.99
IGL01307:Hmcn1 APN 1 150,745,001 (GRCm38) missense possibly damaging 0.84
IGL01318:Hmcn1 APN 1 150,719,240 (GRCm38) missense probably damaging 1.00
IGL01403:Hmcn1 APN 1 150,593,097 (GRCm38) missense probably damaging 1.00
IGL01417:Hmcn1 APN 1 150,859,239 (GRCm38) missense probably damaging 1.00
IGL01503:Hmcn1 APN 1 150,605,072 (GRCm38) missense probably benign 0.38
IGL01509:Hmcn1 APN 1 150,609,631 (GRCm38) missense probably damaging 1.00
IGL01550:Hmcn1 APN 1 150,598,397 (GRCm38) missense probably damaging 1.00
IGL01601:Hmcn1 APN 1 150,627,413 (GRCm38) missense probably benign 0.01
IGL01617:Hmcn1 APN 1 150,672,032 (GRCm38) missense probably benign 0.05
IGL01636:Hmcn1 APN 1 150,580,233 (GRCm38) missense probably damaging 1.00
IGL01662:Hmcn1 APN 1 150,737,299 (GRCm38) missense possibly damaging 0.46
IGL01693:Hmcn1 APN 1 150,583,280 (GRCm38) missense probably damaging 1.00
IGL01723:Hmcn1 APN 1 150,744,960 (GRCm38) missense probably benign 0.01
IGL01776:Hmcn1 APN 1 150,672,038 (GRCm38) missense possibly damaging 0.70
IGL01783:Hmcn1 APN 1 150,615,300 (GRCm38) missense possibly damaging 0.60
IGL01789:Hmcn1 APN 1 150,690,601 (GRCm38) missense probably damaging 1.00
IGL01900:Hmcn1 APN 1 150,742,260 (GRCm38) splice site probably benign
IGL01906:Hmcn1 APN 1 150,667,887 (GRCm38) missense probably benign 0.01
IGL01947:Hmcn1 APN 1 150,732,892 (GRCm38) missense possibly damaging 0.93
IGL01958:Hmcn1 APN 1 150,603,871 (GRCm38) missense probably benign 0.01
IGL02002:Hmcn1 APN 1 150,615,298 (GRCm38) missense probably damaging 1.00
IGL02058:Hmcn1 APN 1 150,704,181 (GRCm38) missense probably benign 0.02
IGL02115:Hmcn1 APN 1 150,630,728 (GRCm38) missense probably damaging 1.00
IGL02127:Hmcn1 APN 1 150,722,607 (GRCm38) missense probably benign
IGL02155:Hmcn1 APN 1 150,563,598 (GRCm38) missense probably damaging 1.00
IGL02222:Hmcn1 APN 1 150,806,401 (GRCm38) missense probably benign 0.05
IGL02293:Hmcn1 APN 1 150,664,915 (GRCm38) missense probably damaging 0.97
IGL02398:Hmcn1 APN 1 150,802,897 (GRCm38) missense possibly damaging 0.78
IGL02420:Hmcn1 APN 1 150,722,424 (GRCm38) missense probably damaging 1.00
IGL02553:Hmcn1 APN 1 150,993,023 (GRCm38) missense probably benign 0.12
IGL02561:Hmcn1 APN 1 150,809,726 (GRCm38) missense probably benign 0.32
IGL02569:Hmcn1 APN 1 150,697,493 (GRCm38) missense probably benign 0.01
IGL02607:Hmcn1 APN 1 150,744,995 (GRCm38) missense possibly damaging 0.88
IGL02676:Hmcn1 APN 1 150,619,009 (GRCm38) missense probably benign 0.01
IGL02725:Hmcn1 APN 1 150,604,903 (GRCm38) missense possibly damaging 0.92
IGL02726:Hmcn1 APN 1 150,656,694 (GRCm38) nonsense probably null
IGL02735:Hmcn1 APN 1 150,646,832 (GRCm38) missense probably benign 0.02
IGL02737:Hmcn1 APN 1 150,563,828 (GRCm38) missense probably damaging 1.00
IGL02892:Hmcn1 APN 1 150,675,974 (GRCm38) critical splice donor site probably null
IGL02927:Hmcn1 APN 1 150,577,278 (GRCm38) missense probably damaging 1.00
IGL02931:Hmcn1 APN 1 150,657,207 (GRCm38) missense probably benign 0.37
IGL02936:Hmcn1 APN 1 150,697,522 (GRCm38) missense probably damaging 0.98
IGL02985:Hmcn1 APN 1 150,671,917 (GRCm38) missense probably damaging 1.00
IGL03027:Hmcn1 APN 1 150,808,539 (GRCm38) missense probably benign
IGL03195:Hmcn1 APN 1 150,802,909 (GRCm38) missense probably benign 0.06
IGL03217:Hmcn1 APN 1 150,743,667 (GRCm38) missense possibly damaging 0.58
IGL03232:Hmcn1 APN 1 150,770,352 (GRCm38) splice site probably benign
IGL03268:Hmcn1 APN 1 150,772,510 (GRCm38) missense probably damaging 1.00
IGL03271:Hmcn1 APN 1 150,598,424 (GRCm38) missense possibly damaging 0.92
IGL03304:Hmcn1 APN 1 150,630,231 (GRCm38) missense probably damaging 0.97
IGL03329:Hmcn1 APN 1 150,732,910 (GRCm38) missense probably damaging 1.00
IGL03339:Hmcn1 APN 1 150,701,969 (GRCm38) missense probably benign 0.04
IGL03368:Hmcn1 APN 1 150,663,872 (GRCm38) missense probably damaging 1.00
Backbone UTSW 1 150,622,994 (GRCm38) missense probably benign 0.09
Cambrian UTSW 1 150,732,846 (GRCm38) missense probably damaging 1.00
chordate UTSW 1 150,587,015 (GRCm38) missense probably benign 0.00
Justamere UTSW 1 150,588,257 (GRCm38) missense probably damaging 1.00
Lancelet UTSW 1 150,675,540 (GRCm38) missense probably benign 0.00
notochord UTSW 1 150,770,293 (GRCm38) missense probably benign 0.00
wippoorwill UTSW 1 150,732,946 (GRCm38) missense probably damaging 1.00
BB004:Hmcn1 UTSW 1 150,609,775 (GRCm38) missense probably damaging 1.00
BB014:Hmcn1 UTSW 1 150,609,775 (GRCm38) missense probably damaging 1.00
IGL02991:Hmcn1 UTSW 1 150,738,658 (GRCm38) missense possibly damaging 0.56
P0017:Hmcn1 UTSW 1 150,720,689 (GRCm38) missense possibly damaging 0.49
PIT1430001:Hmcn1 UTSW 1 150,808,737 (GRCm38) missense probably benign 0.00
PIT4514001:Hmcn1 UTSW 1 150,669,487 (GRCm38) missense possibly damaging 0.93
R0006:Hmcn1 UTSW 1 150,808,676 (GRCm38) missense probably damaging 0.99
R0018:Hmcn1 UTSW 1 150,652,551 (GRCm38) missense probably benign 0.16
R0052:Hmcn1 UTSW 1 150,677,406 (GRCm38) missense probably damaging 1.00
R0107:Hmcn1 UTSW 1 150,587,015 (GRCm38) missense probably benign 0.00
R0115:Hmcn1 UTSW 1 150,808,647 (GRCm38) missense possibly damaging 0.88
R0149:Hmcn1 UTSW 1 150,677,324 (GRCm38) missense probably benign 0.00
R0152:Hmcn1 UTSW 1 150,663,879 (GRCm38) missense probably benign 0.01
R0381:Hmcn1 UTSW 1 150,603,811 (GRCm38) missense probably damaging 1.00
R0398:Hmcn1 UTSW 1 150,798,814 (GRCm38) missense possibly damaging 0.83
R0414:Hmcn1 UTSW 1 150,715,822 (GRCm38) missense possibly damaging 0.72
R0494:Hmcn1 UTSW 1 150,732,792 (GRCm38) splice site probably benign
R0503:Hmcn1 UTSW 1 150,859,252 (GRCm38) missense probably damaging 1.00
R0504:Hmcn1 UTSW 1 150,876,419 (GRCm38) splice site probably benign
R0506:Hmcn1 UTSW 1 150,742,341 (GRCm38) missense possibly damaging 0.69
R0554:Hmcn1 UTSW 1 150,719,117 (GRCm38) missense probably benign 0.34
R0576:Hmcn1 UTSW 1 150,650,017 (GRCm38) nonsense probably null
R0599:Hmcn1 UTSW 1 150,609,801 (GRCm38) missense possibly damaging 0.91
R0605:Hmcn1 UTSW 1 150,657,376 (GRCm38) critical splice donor site probably null
R0607:Hmcn1 UTSW 1 150,638,900 (GRCm38) missense probably benign 0.01
R0620:Hmcn1 UTSW 1 150,594,016 (GRCm38) missense probably benign 0.04
R0626:Hmcn1 UTSW 1 150,798,719 (GRCm38) splice site probably null
R0699:Hmcn1 UTSW 1 150,819,410 (GRCm38) missense probably damaging 1.00
R0765:Hmcn1 UTSW 1 150,808,787 (GRCm38) missense probably damaging 1.00
R0782:Hmcn1 UTSW 1 150,753,665 (GRCm38) missense possibly damaging 0.82
R0783:Hmcn1 UTSW 1 150,650,073 (GRCm38) missense probably damaging 1.00
R0841:Hmcn1 UTSW 1 150,679,607 (GRCm38) splice site probably null
R0975:Hmcn1 UTSW 1 150,577,377 (GRCm38) missense probably benign 0.00
R1070:Hmcn1 UTSW 1 150,689,590 (GRCm38) missense probably damaging 0.98
R1118:Hmcn1 UTSW 1 150,618,928 (GRCm38) missense possibly damaging 0.56
R1119:Hmcn1 UTSW 1 150,618,928 (GRCm38) missense possibly damaging 0.56
R1145:Hmcn1 UTSW 1 150,679,607 (GRCm38) splice site probably null
R1145:Hmcn1 UTSW 1 150,679,607 (GRCm38) splice site probably null
R1233:Hmcn1 UTSW 1 150,749,026 (GRCm38) missense probably benign
R1234:Hmcn1 UTSW 1 150,753,654 (GRCm38) nonsense probably null
R1291:Hmcn1 UTSW 1 150,748,191 (GRCm38) missense probably damaging 1.00
R1334:Hmcn1 UTSW 1 150,586,468 (GRCm38) missense possibly damaging 0.73
R1372:Hmcn1 UTSW 1 150,680,715 (GRCm38) missense probably benign 0.22
R1424:Hmcn1 UTSW 1 150,646,794 (GRCm38) missense probably benign 0.00
R1450:Hmcn1 UTSW 1 150,652,506 (GRCm38) splice site probably benign
R1458:Hmcn1 UTSW 1 150,609,700 (GRCm38) missense probably damaging 1.00
R1467:Hmcn1 UTSW 1 150,689,590 (GRCm38) missense probably damaging 0.98
R1467:Hmcn1 UTSW 1 150,689,590 (GRCm38) missense probably damaging 0.98
R1473:Hmcn1 UTSW 1 150,772,552 (GRCm38) missense probably benign 0.03
R1517:Hmcn1 UTSW 1 150,669,421 (GRCm38) missense probably damaging 1.00
R1527:Hmcn1 UTSW 1 150,773,803 (GRCm38) missense probably benign 0.00
R1557:Hmcn1 UTSW 1 150,734,532 (GRCm38) missense possibly damaging 0.86
R1576:Hmcn1 UTSW 1 150,657,241 (GRCm38) missense possibly damaging 0.77
R1617:Hmcn1 UTSW 1 150,745,027 (GRCm38) missense probably damaging 0.98
R1635:Hmcn1 UTSW 1 150,669,558 (GRCm38) missense probably benign 0.00
R1655:Hmcn1 UTSW 1 150,630,333 (GRCm38) missense probably benign 0.03
R1698:Hmcn1 UTSW 1 150,565,369 (GRCm38) nonsense probably null
R1710:Hmcn1 UTSW 1 150,675,984 (GRCm38) missense probably damaging 1.00
R1717:Hmcn1 UTSW 1 150,859,186 (GRCm38) missense probably damaging 1.00
R1753:Hmcn1 UTSW 1 150,586,468 (GRCm38) missense possibly damaging 0.73
R1756:Hmcn1 UTSW 1 150,599,030 (GRCm38) missense probably damaging 1.00
R1772:Hmcn1 UTSW 1 150,563,568 (GRCm38) missense probably damaging 0.99
R1794:Hmcn1 UTSW 1 150,627,152 (GRCm38) missense probably damaging 0.98
R1794:Hmcn1 UTSW 1 150,598,285 (GRCm38) missense probably benign 0.00
R1856:Hmcn1 UTSW 1 150,721,664 (GRCm38) missense probably benign 0.02
R1859:Hmcn1 UTSW 1 150,657,193 (GRCm38) missense probably damaging 1.00
R1862:Hmcn1 UTSW 1 150,638,900 (GRCm38) missense probably benign 0.01
R1865:Hmcn1 UTSW 1 150,603,812 (GRCm38) missense probably damaging 1.00
R1874:Hmcn1 UTSW 1 150,720,695 (GRCm38) missense probably damaging 1.00
R1880:Hmcn1 UTSW 1 150,638,900 (GRCm38) missense probably benign 0.01
R1881:Hmcn1 UTSW 1 150,638,900 (GRCm38) missense probably benign 0.01
R1886:Hmcn1 UTSW 1 150,577,295 (GRCm38) missense probably benign 0.02
R1888:Hmcn1 UTSW 1 150,819,500 (GRCm38) missense possibly damaging 0.82
R1888:Hmcn1 UTSW 1 150,819,500 (GRCm38) missense possibly damaging 0.82
R1899:Hmcn1 UTSW 1 150,657,451 (GRCm38) missense probably damaging 1.00
R1905:Hmcn1 UTSW 1 150,992,855 (GRCm38) missense probably damaging 1.00
R1912:Hmcn1 UTSW 1 150,604,882 (GRCm38) missense probably benign 0.28
R1959:Hmcn1 UTSW 1 150,649,676 (GRCm38) missense probably benign 0.00
R1960:Hmcn1 UTSW 1 150,677,376 (GRCm38) missense possibly damaging 0.72
R1960:Hmcn1 UTSW 1 150,675,991 (GRCm38) missense probably benign 0.00
R2001:Hmcn1 UTSW 1 150,738,613 (GRCm38) missense possibly damaging 0.81
R2011:Hmcn1 UTSW 1 150,677,334 (GRCm38) missense probably benign 0.01
R2075:Hmcn1 UTSW 1 150,577,323 (GRCm38) missense possibly damaging 0.86
R2136:Hmcn1 UTSW 1 150,633,659 (GRCm38) missense probably damaging 1.00
R2192:Hmcn1 UTSW 1 150,715,815 (GRCm38) missense probably damaging 0.97
R2267:Hmcn1 UTSW 1 150,599,010 (GRCm38) missense probably benign 0.00
R2268:Hmcn1 UTSW 1 150,624,598 (GRCm38) splice site probably benign
R2303:Hmcn1 UTSW 1 150,704,226 (GRCm38) missense probably damaging 1.00
R2330:Hmcn1 UTSW 1 150,652,678 (GRCm38) splice site probably benign
R2338:Hmcn1 UTSW 1 150,622,934 (GRCm38) missense possibly damaging 0.89
R2380:Hmcn1 UTSW 1 150,565,384 (GRCm38) missense probably benign 0.01
R2405:Hmcn1 UTSW 1 150,860,341 (GRCm38) missense probably damaging 1.00
R2443:Hmcn1 UTSW 1 150,599,032 (GRCm38) missense probably benign 0.01
R2496:Hmcn1 UTSW 1 150,615,221 (GRCm38) missense probably benign 0.01
R2504:Hmcn1 UTSW 1 150,686,867 (GRCm38) nonsense probably null
R2519:Hmcn1 UTSW 1 150,773,820 (GRCm38) nonsense probably null
R2520:Hmcn1 UTSW 1 150,743,647 (GRCm38) missense possibly damaging 0.72
R2679:Hmcn1 UTSW 1 150,652,575 (GRCm38) missense possibly damaging 0.67
R2831:Hmcn1 UTSW 1 150,630,652 (GRCm38) critical splice donor site probably null
R2847:Hmcn1 UTSW 1 150,563,599 (GRCm38) nonsense probably null
R2849:Hmcn1 UTSW 1 150,563,599 (GRCm38) nonsense probably null
R2869:Hmcn1 UTSW 1 150,738,716 (GRCm38) missense possibly damaging 0.95
R2869:Hmcn1 UTSW 1 150,738,716 (GRCm38) missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150,738,716 (GRCm38) missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150,738,716 (GRCm38) missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150,738,716 (GRCm38) missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150,738,716 (GRCm38) missense possibly damaging 0.95
R2873:Hmcn1 UTSW 1 150,738,716 (GRCm38) missense possibly damaging 0.95
R2897:Hmcn1 UTSW 1 150,802,873 (GRCm38) missense probably damaging 1.00
R2905:Hmcn1 UTSW 1 150,749,035 (GRCm38) missense probably damaging 1.00
R3498:Hmcn1 UTSW 1 150,605,102 (GRCm38) missense probably damaging 0.98
R3499:Hmcn1 UTSW 1 150,605,102 (GRCm38) missense probably damaging 0.98
R3724:Hmcn1 UTSW 1 150,689,518 (GRCm38) missense possibly damaging 0.82
R3765:Hmcn1 UTSW 1 150,745,025 (GRCm38) missense possibly damaging 0.72
R3778:Hmcn1 UTSW 1 150,802,824 (GRCm38) missense possibly damaging 0.95
R3790:Hmcn1 UTSW 1 150,622,994 (GRCm38) missense probably benign 0.09
R3796:Hmcn1 UTSW 1 150,586,418 (GRCm38) missense probably damaging 1.00
R3811:Hmcn1 UTSW 1 150,649,577 (GRCm38) critical splice donor site probably null
R3825:Hmcn1 UTSW 1 150,586,965 (GRCm38) missense probably benign 0.28
R3890:Hmcn1 UTSW 1 150,635,195 (GRCm38) missense probably damaging 1.00
R3891:Hmcn1 UTSW 1 150,635,195 (GRCm38) missense probably damaging 1.00
R3892:Hmcn1 UTSW 1 150,635,195 (GRCm38) missense probably damaging 1.00
R3918:Hmcn1 UTSW 1 150,690,610 (GRCm38) missense probably benign 0.00
R3964:Hmcn1 UTSW 1 150,573,569 (GRCm38) missense probably benign 0.00
R4005:Hmcn1 UTSW 1 150,722,453 (GRCm38) missense possibly damaging 0.88
R4026:Hmcn1 UTSW 1 150,722,369 (GRCm38) missense probably benign 0.03
R4037:Hmcn1 UTSW 1 150,772,502 (GRCm38) missense probably benign 0.00
R4088:Hmcn1 UTSW 1 150,703,216 (GRCm38) missense possibly damaging 0.58
R4096:Hmcn1 UTSW 1 150,658,508 (GRCm38) missense probably benign 0.20
R4169:Hmcn1 UTSW 1 150,595,999 (GRCm38) splice site probably null
R4441:Hmcn1 UTSW 1 150,657,459 (GRCm38) missense probably null
R4493:Hmcn1 UTSW 1 150,701,899 (GRCm38) missense probably damaging 1.00
R4501:Hmcn1 UTSW 1 150,633,666 (GRCm38) missense probably damaging 1.00
R4535:Hmcn1 UTSW 1 150,563,780 (GRCm38) missense probably damaging 0.99
R4576:Hmcn1 UTSW 1 150,734,487 (GRCm38) missense probably benign
R4601:Hmcn1 UTSW 1 150,738,645 (GRCm38) missense probably damaging 0.99
R4627:Hmcn1 UTSW 1 150,595,894 (GRCm38) missense probably benign 0.11
R4647:Hmcn1 UTSW 1 150,675,511 (GRCm38) critical splice donor site probably null
R4657:Hmcn1 UTSW 1 150,624,550 (GRCm38) missense probably damaging 1.00
R4717:Hmcn1 UTSW 1 150,619,065 (GRCm38) missense probably benign 0.00
R4721:Hmcn1 UTSW 1 150,772,571 (GRCm38) splice site probably null
R4724:Hmcn1 UTSW 1 150,694,833 (GRCm38) splice site probably null
R4737:Hmcn1 UTSW 1 150,689,595 (GRCm38) missense possibly damaging 0.90
R4744:Hmcn1 UTSW 1 150,577,612 (GRCm38) missense probably damaging 1.00
R4795:Hmcn1 UTSW 1 150,753,611 (GRCm38) missense probably benign 0.00
R4796:Hmcn1 UTSW 1 150,753,611 (GRCm38) missense probably benign 0.00
R4871:Hmcn1 UTSW 1 150,593,085 (GRCm38) missense probably benign 0.02
R4895:Hmcn1 UTSW 1 150,677,379 (GRCm38) missense probably benign 0.00
R4934:Hmcn1 UTSW 1 150,722,535 (GRCm38) missense probably damaging 1.00
R4953:Hmcn1 UTSW 1 150,876,360 (GRCm38) intron probably benign
R4968:Hmcn1 UTSW 1 150,657,470 (GRCm38) missense possibly damaging 0.67
R4974:Hmcn1 UTSW 1 150,819,449 (GRCm38) missense probably benign 0.01
R5024:Hmcn1 UTSW 1 150,680,688 (GRCm38) missense possibly damaging 0.65
R5031:Hmcn1 UTSW 1 150,588,257 (GRCm38) missense probably damaging 1.00
R5093:Hmcn1 UTSW 1 150,737,256 (GRCm38) missense probably benign 0.14
R5096:Hmcn1 UTSW 1 150,610,669 (GRCm38) missense probably damaging 1.00
R5185:Hmcn1 UTSW 1 150,656,741 (GRCm38) missense probably benign 0.03
R5228:Hmcn1 UTSW 1 150,646,701 (GRCm38) missense probably benign 0.00
R5260:Hmcn1 UTSW 1 150,595,861 (GRCm38) missense possibly damaging 0.65
R5264:Hmcn1 UTSW 1 150,679,514 (GRCm38) missense probably benign 0.01
R5282:Hmcn1 UTSW 1 150,582,296 (GRCm38) missense probably damaging 1.00
R5334:Hmcn1 UTSW 1 150,755,372 (GRCm38) missense probably damaging 0.99
R5346:Hmcn1 UTSW 1 150,623,244 (GRCm38) missense probably damaging 1.00
R5423:Hmcn1 UTSW 1 150,701,972 (GRCm38) missense probably damaging 1.00
R5484:Hmcn1 UTSW 1 150,675,540 (GRCm38) missense probably benign 0.00
R5491:Hmcn1 UTSW 1 150,609,825 (GRCm38) splice site probably null
R5531:Hmcn1 UTSW 1 150,743,788 (GRCm38) missense probably damaging 1.00
R5536:Hmcn1 UTSW 1 150,755,291 (GRCm38) missense probably benign 0.01
R5547:Hmcn1 UTSW 1 150,737,506 (GRCm38) missense possibly damaging 0.64
R5580:Hmcn1 UTSW 1 150,577,539 (GRCm38) missense probably benign 0.43
R5626:Hmcn1 UTSW 1 150,656,567 (GRCm38) missense probably damaging 1.00
R5657:Hmcn1 UTSW 1 150,658,562 (GRCm38) missense probably benign 0.02
R5677:Hmcn1 UTSW 1 150,609,778 (GRCm38) missense probably benign 0.00
R5718:Hmcn1 UTSW 1 150,690,600 (GRCm38) nonsense probably null
R5718:Hmcn1 UTSW 1 150,609,666 (GRCm38) missense probably damaging 1.00
R5723:Hmcn1 UTSW 1 150,694,849 (GRCm38) missense possibly damaging 0.95
R5739:Hmcn1 UTSW 1 150,758,474 (GRCm38) splice site probably null
R5739:Hmcn1 UTSW 1 150,808,697 (GRCm38) missense probably benign 0.45
R5751:Hmcn1 UTSW 1 150,573,554 (GRCm38) missense probably damaging 1.00
R5772:Hmcn1 UTSW 1 150,694,878 (GRCm38) missense possibly damaging 0.47
R5804:Hmcn1 UTSW 1 150,674,347 (GRCm38) nonsense probably null
R5809:Hmcn1 UTSW 1 150,649,607 (GRCm38) missense probably damaging 1.00
R5817:Hmcn1 UTSW 1 150,737,524 (GRCm38) missense possibly damaging 0.77
R5824:Hmcn1 UTSW 1 150,993,023 (GRCm38) missense probably benign 0.12
R5881:Hmcn1 UTSW 1 150,630,327 (GRCm38) missense probably damaging 0.99
R5928:Hmcn1 UTSW 1 150,598,897 (GRCm38) missense possibly damaging 0.64
R5929:Hmcn1 UTSW 1 150,577,296 (GRCm38) nonsense probably null
R5940:Hmcn1 UTSW 1 150,657,222 (GRCm38) missense probably benign 0.41
R5973:Hmcn1 UTSW 1 150,563,817 (GRCm38) missense probably damaging 1.00
R5997:Hmcn1 UTSW 1 150,704,173 (GRCm38) missense possibly damaging 0.74
R6027:Hmcn1 UTSW 1 150,802,895 (GRCm38) missense possibly damaging 0.79
R6029:Hmcn1 UTSW 1 150,632,437 (GRCm38) missense probably benign 0.13
R6056:Hmcn1 UTSW 1 150,663,909 (GRCm38) missense probably damaging 1.00
R6065:Hmcn1 UTSW 1 150,770,330 (GRCm38) missense probably benign 0.06
R6083:Hmcn1 UTSW 1 150,755,294 (GRCm38) missense probably damaging 1.00
R6083:Hmcn1 UTSW 1 150,755,293 (GRCm38) missense probably damaging 1.00
R6108:Hmcn1 UTSW 1 150,631,227 (GRCm38) missense possibly damaging 0.95
R6112:Hmcn1 UTSW 1 150,618,936 (GRCm38) missense probably damaging 1.00
R6140:Hmcn1 UTSW 1 150,732,846 (GRCm38) missense probably damaging 1.00
R6144:Hmcn1 UTSW 1 150,722,424 (GRCm38) missense probably damaging 1.00
R6152:Hmcn1 UTSW 1 150,565,425 (GRCm38) missense probably damaging 1.00
R6174:Hmcn1 UTSW 1 150,646,784 (GRCm38) missense probably benign 0.06
R6185:Hmcn1 UTSW 1 150,615,438 (GRCm38) splice site probably null
R6187:Hmcn1 UTSW 1 150,630,728 (GRCm38) missense probably damaging 1.00
R6276:Hmcn1 UTSW 1 150,738,681 (GRCm38) missense possibly damaging 0.69
R6278:Hmcn1 UTSW 1 150,697,419 (GRCm38) critical splice donor site probably null
R6427:Hmcn1 UTSW 1 150,697,476 (GRCm38) missense possibly damaging 0.85
R6431:Hmcn1 UTSW 1 150,744,960 (GRCm38) missense probably benign 0.01
R6441:Hmcn1 UTSW 1 150,703,216 (GRCm38) missense possibly damaging 0.58
R6451:Hmcn1 UTSW 1 150,992,919 (GRCm38) missense probably damaging 1.00
R6478:Hmcn1 UTSW 1 150,664,784 (GRCm38) missense probably damaging 1.00
R6479:Hmcn1 UTSW 1 150,677,302 (GRCm38) nonsense probably null
R6490:Hmcn1 UTSW 1 150,583,278 (GRCm38) missense probably benign 0.00
R6525:Hmcn1 UTSW 1 150,697,566 (GRCm38) missense probably damaging 1.00
R6571:Hmcn1 UTSW 1 150,615,438 (GRCm38) splice site probably null
R6612:Hmcn1 UTSW 1 150,595,118 (GRCm38) critical splice donor site probably null
R6616:Hmcn1 UTSW 1 150,723,257 (GRCm38) critical splice donor site probably null
R6617:Hmcn1 UTSW 1 150,743,796 (GRCm38) missense probably benign 0.01
R6623:Hmcn1 UTSW 1 150,758,306 (GRCm38) missense probably benign
R6687:Hmcn1 UTSW 1 150,745,033 (GRCm38) missense probably benign 0.30
R6714:Hmcn1 UTSW 1 150,704,175 (GRCm38) missense probably damaging 0.97
R6751:Hmcn1 UTSW 1 150,734,518 (GRCm38) missense probably damaging 0.98
R6831:Hmcn1 UTSW 1 150,770,293 (GRCm38) missense probably benign 0.00
R6971:Hmcn1 UTSW 1 150,993,051 (GRCm38) start codon destroyed probably benign 0.00
R7048:Hmcn1 UTSW 1 150,599,653 (GRCm38) critical splice acceptor site probably null
R7058:Hmcn1 UTSW 1 150,773,890 (GRCm38) missense probably benign 0.43
R7071:Hmcn1 UTSW 1 150,604,102 (GRCm38) missense probably damaging 1.00
R7078:Hmcn1 UTSW 1 150,860,367 (GRCm38) missense probably damaging 1.00
R7092:Hmcn1 UTSW 1 150,604,246 (GRCm38) missense probably damaging 1.00
R7120:Hmcn1 UTSW 1 150,700,541 (GRCm38) missense probably damaging 0.98
R7129:Hmcn1 UTSW 1 150,577,210 (GRCm38) splice site probably null
R7144:Hmcn1 UTSW 1 150,663,873 (GRCm38) missense probably damaging 1.00
R7148:Hmcn1 UTSW 1 150,686,854 (GRCm38) missense probably benign 0.00
R7162:Hmcn1 UTSW 1 150,748,993 (GRCm38) missense probably benign 0.18
R7172:Hmcn1 UTSW 1 150,753,699 (GRCm38) missense possibly damaging 0.92
R7193:Hmcn1 UTSW 1 150,649,580 (GRCm38) missense probably null 1.00
R7231:Hmcn1 UTSW 1 150,638,876 (GRCm38) missense probably benign 0.00
R7237:Hmcn1 UTSW 1 150,722,643 (GRCm38) missense probably damaging 0.98
R7258:Hmcn1 UTSW 1 150,715,823 (GRCm38) missense probably benign 0.12
R7286:Hmcn1 UTSW 1 150,582,337 (GRCm38) missense probably damaging 0.98
R7289:Hmcn1 UTSW 1 150,683,715 (GRCm38) missense possibly damaging 0.52
R7292:Hmcn1 UTSW 1 150,733,129 (GRCm38) splice site probably null
R7316:Hmcn1 UTSW 1 150,732,946 (GRCm38) missense probably damaging 1.00
R7327:Hmcn1 UTSW 1 150,603,814 (GRCm38) missense probably benign 0.01
R7328:Hmcn1 UTSW 1 150,638,866 (GRCm38) missense possibly damaging 0.95
R7346:Hmcn1 UTSW 1 150,683,745 (GRCm38) missense probably damaging 1.00
R7351:Hmcn1 UTSW 1 150,667,889 (GRCm38) missense probably damaging 0.98
R7354:Hmcn1 UTSW 1 150,806,445 (GRCm38) nonsense probably null
R7360:Hmcn1 UTSW 1 150,618,846 (GRCm38) missense probably damaging 1.00
R7396:Hmcn1 UTSW 1 150,563,631 (GRCm38) missense possibly damaging 0.83
R7398:Hmcn1 UTSW 1 150,646,670 (GRCm38) missense probably benign 0.00
R7400:Hmcn1 UTSW 1 150,674,430 (GRCm38) missense probably damaging 1.00
R7404:Hmcn1 UTSW 1 150,720,759 (GRCm38) missense probably benign 0.00
R7424:Hmcn1 UTSW 1 150,630,266 (GRCm38) nonsense probably null
R7454:Hmcn1 UTSW 1 150,563,604 (GRCm38) missense probably damaging 1.00
R7476:Hmcn1 UTSW 1 150,580,267 (GRCm38) missense probably damaging 0.99
R7480:Hmcn1 UTSW 1 150,677,234 (GRCm38) critical splice donor site probably null
R7516:Hmcn1 UTSW 1 150,622,967 (GRCm38) missense probably benign 0.35
R7526:Hmcn1 UTSW 1 150,656,573 (GRCm38) missense probably damaging 1.00
R7531:Hmcn1 UTSW 1 150,686,780 (GRCm38) missense probably benign 0.06
R7555:Hmcn1 UTSW 1 150,604,874 (GRCm38) missense probably benign 0.40
R7564:Hmcn1 UTSW 1 150,655,835 (GRCm38) missense probably benign
R7588:Hmcn1 UTSW 1 150,657,134 (GRCm38) missense possibly damaging 0.90
R7719:Hmcn1 UTSW 1 150,565,329 (GRCm38) missense possibly damaging 0.95
R7720:Hmcn1 UTSW 1 150,646,709 (GRCm38) missense probably benign 0.00
R7722:Hmcn1 UTSW 1 150,667,880 (GRCm38) missense probably damaging 0.98
R7761:Hmcn1 UTSW 1 150,722,445 (GRCm38) missense possibly damaging 0.70
R7787:Hmcn1 UTSW 1 150,756,592 (GRCm38) missense probably damaging 1.00
R7803:Hmcn1 UTSW 1 150,770,279 (GRCm38) missense probably benign 0.32
R7862:Hmcn1 UTSW 1 150,806,421 (GRCm38) missense probably damaging 0.96
R7876:Hmcn1 UTSW 1 150,744,971 (GRCm38) missense probably benign 0.03
R7886:Hmcn1 UTSW 1 150,657,470 (GRCm38) missense possibly damaging 0.94
R7891:Hmcn1 UTSW 1 150,593,189 (GRCm38) missense probably damaging 1.00
R7892:Hmcn1 UTSW 1 150,664,892 (GRCm38) missense probably benign 0.00
R7927:Hmcn1 UTSW 1 150,609,775 (GRCm38) missense probably damaging 1.00
R7941:Hmcn1 UTSW 1 150,650,084 (GRCm38) missense possibly damaging 0.95
R7960:Hmcn1 UTSW 1 150,655,855 (GRCm38) missense probably damaging 1.00
R8001:Hmcn1 UTSW 1 150,664,878 (GRCm38) nonsense probably null
R8015:Hmcn1 UTSW 1 150,598,311 (GRCm38) missense possibly damaging 0.83
R8070:Hmcn1 UTSW 1 150,649,992 (GRCm38) nonsense probably null
R8072:Hmcn1 UTSW 1 150,656,505 (GRCm38) missense possibly damaging 0.62
R8113:Hmcn1 UTSW 1 150,749,090 (GRCm38) missense possibly damaging 0.50
R8143:Hmcn1 UTSW 1 150,859,206 (GRCm38) missense probably benign 0.03
R8145:Hmcn1 UTSW 1 150,753,660 (GRCm38) missense probably benign 0.33
R8155:Hmcn1 UTSW 1 150,604,954 (GRCm38) missense probably damaging 1.00
R8165:Hmcn1 UTSW 1 150,646,658 (GRCm38) missense probably benign 0.09
R8179:Hmcn1 UTSW 1 150,722,514 (GRCm38) missense probably benign 0.19
R8193:Hmcn1 UTSW 1 150,577,477 (GRCm38) nonsense probably null
R8234:Hmcn1 UTSW 1 150,594,010 (GRCm38) missense possibly damaging 0.83
R8249:Hmcn1 UTSW 1 150,819,366 (GRCm38) missense probably benign 0.24
R8267:Hmcn1 UTSW 1 150,859,254 (GRCm38) missense probably damaging 1.00
R8312:Hmcn1 UTSW 1 150,738,764 (GRCm38) missense probably damaging 0.99
R8338:Hmcn1 UTSW 1 150,738,734 (GRCm38) missense probably benign 0.35
R8354:Hmcn1 UTSW 1 150,758,391 (GRCm38) missense possibly damaging 0.79
R8440:Hmcn1 UTSW 1 150,694,920 (GRCm38) missense probably damaging 1.00
R8473:Hmcn1 UTSW 1 150,603,800 (GRCm38) missense possibly damaging 0.64
R8497:Hmcn1 UTSW 1 150,580,239 (GRCm38) missense probably benign 0.01
R8509:Hmcn1 UTSW 1 150,573,551 (GRCm38) nonsense probably null
R8559:Hmcn1 UTSW 1 150,676,038 (GRCm38) missense probably benign 0.25
R8701:Hmcn1 UTSW 1 150,755,257 (GRCm38) missense probably benign 0.00
R8755:Hmcn1 UTSW 1 150,633,620 (GRCm38) missense probably benign 0.19
R8765:Hmcn1 UTSW 1 150,680,662 (GRCm38) missense probably damaging 0.98
R8782:Hmcn1 UTSW 1 150,664,885 (GRCm38) missense probably benign 0.08
R8794:Hmcn1 UTSW 1 150,715,718 (GRCm38) missense probably benign 0.00
R8803:Hmcn1 UTSW 1 150,734,497 (GRCm38) missense probably damaging 1.00
R8808:Hmcn1 UTSW 1 150,655,819 (GRCm38) missense possibly damaging 0.64
R8853:Hmcn1 UTSW 1 150,671,975 (GRCm38) missense probably damaging 1.00
R8877:Hmcn1 UTSW 1 150,638,908 (GRCm38) missense probably benign 0.00
R8881:Hmcn1 UTSW 1 150,649,972 (GRCm38) missense probably damaging 1.00
R8916:Hmcn1 UTSW 1 150,773,779 (GRCm38) missense probably damaging 1.00
R9008:Hmcn1 UTSW 1 150,755,044 (GRCm38) intron probably benign
R9030:Hmcn1 UTSW 1 150,817,119 (GRCm38) missense probably benign 0.00
R9072:Hmcn1 UTSW 1 150,689,569 (GRCm38) missense probably benign 0.04
R9090:Hmcn1 UTSW 1 150,756,558 (GRCm38) missense probably damaging 1.00
R9096:Hmcn1 UTSW 1 150,657,118 (GRCm38) missense probably benign 0.04
R9102:Hmcn1 UTSW 1 150,697,580 (GRCm38) missense probably benign 0.01
R9146:Hmcn1 UTSW 1 150,598,390 (GRCm38) missense probably benign 0.02
R9157:Hmcn1 UTSW 1 150,646,592 (GRCm38) missense probably benign 0.06
R9169:Hmcn1 UTSW 1 150,630,341 (GRCm38) missense probably damaging 0.99
R9182:Hmcn1 UTSW 1 150,612,654 (GRCm38) missense probably damaging 1.00
R9182:Hmcn1 UTSW 1 150,624,586 (GRCm38) nonsense probably null
R9204:Hmcn1 UTSW 1 150,734,511 (GRCm38) missense probably benign 0.40
R9219:Hmcn1 UTSW 1 150,719,093 (GRCm38) critical splice donor site probably null
R9267:Hmcn1 UTSW 1 150,597,989 (GRCm38) missense probably benign 0.26
R9271:Hmcn1 UTSW 1 150,756,558 (GRCm38) missense probably damaging 1.00
R9274:Hmcn1 UTSW 1 150,630,295 (GRCm38) missense probably benign 0.01
R9313:Hmcn1 UTSW 1 150,646,592 (GRCm38) missense probably benign 0.06
R9414:Hmcn1 UTSW 1 150,669,436 (GRCm38) missense probably damaging 1.00
R9456:Hmcn1 UTSW 1 150,630,302 (GRCm38) nonsense probably null
R9464:Hmcn1 UTSW 1 150,723,497 (GRCm38) missense possibly damaging 0.80
R9474:Hmcn1 UTSW 1 150,630,720 (GRCm38) missense probably damaging 1.00
R9476:Hmcn1 UTSW 1 150,586,376 (GRCm38) missense probably benign 0.00
R9482:Hmcn1 UTSW 1 150,734,530 (GRCm38) missense probably benign 0.06
R9496:Hmcn1 UTSW 1 150,704,220 (GRCm38) missense probably benign 0.00
R9501:Hmcn1 UTSW 1 150,595,239 (GRCm38) missense possibly damaging 0.67
R9510:Hmcn1 UTSW 1 150,586,376 (GRCm38) missense probably benign 0.00
R9529:Hmcn1 UTSW 1 150,669,424 (GRCm38) missense probably damaging 1.00
R9566:Hmcn1 UTSW 1 150,622,909 (GRCm38) missense probably benign 0.00
R9608:Hmcn1 UTSW 1 150,599,552 (GRCm38) missense probably damaging 1.00
R9609:Hmcn1 UTSW 1 150,679,595 (GRCm38) missense probably damaging 0.96
R9616:Hmcn1 UTSW 1 150,808,722 (GRCm38) missense probably benign 0.16
R9627:Hmcn1 UTSW 1 150,630,303 (GRCm38) missense probably damaging 1.00
R9668:Hmcn1 UTSW 1 150,743,741 (GRCm38) missense probably benign 0.02
R9686:Hmcn1 UTSW 1 150,737,605 (GRCm38) missense probably damaging 0.99
R9717:Hmcn1 UTSW 1 150,609,627 (GRCm38) missense probably damaging 1.00
R9727:Hmcn1 UTSW 1 150,798,815 (GRCm38) missense probably benign 0.06
R9744:Hmcn1 UTSW 1 150,748,190 (GRCm38) missense probably damaging 1.00
R9749:Hmcn1 UTSW 1 150,756,588 (GRCm38) missense possibly damaging 0.94
R9761:Hmcn1 UTSW 1 150,992,874 (GRCm38) missense probably damaging 0.98
R9783:Hmcn1 UTSW 1 150,722,629 (GRCm38) missense probably benign 0.16
R9788:Hmcn1 UTSW 1 150,652,582 (GRCm38) missense probably benign 0.00
R9792:Hmcn1 UTSW 1 150,732,938 (GRCm38) missense possibly damaging 0.94
R9793:Hmcn1 UTSW 1 150,732,938 (GRCm38) missense possibly damaging 0.94
R9795:Hmcn1 UTSW 1 150,732,938 (GRCm38) missense possibly damaging 0.94
R9802:Hmcn1 UTSW 1 150,808,640 (GRCm38) missense probably benign 0.07
RF003:Hmcn1 UTSW 1 150,624,561 (GRCm38) missense probably damaging 1.00
RF005:Hmcn1 UTSW 1 150,635,146 (GRCm38) nonsense probably null
X0022:Hmcn1 UTSW 1 150,700,530 (GRCm38) missense probably benign 0.04
X0027:Hmcn1 UTSW 1 150,860,376 (GRCm38) missense probably damaging 1.00
X0028:Hmcn1 UTSW 1 150,663,901 (GRCm38) missense probably damaging 1.00
Z1088:Hmcn1 UTSW 1 150,648,937 (GRCm38) missense probably damaging 1.00
Z1176:Hmcn1 UTSW 1 150,663,917 (GRCm38) missense probably benign 0.12
Z1176:Hmcn1 UTSW 1 150,655,921 (GRCm38) missense possibly damaging 0.65
Z1176:Hmcn1 UTSW 1 150,586,445 (GRCm38) missense probably null 0.92
Predicted Primers PCR Primer
(F):5'- TGCATGGGCCATTTCAAAGG -3'
(R):5'- CAGGATGGAGGAACACTACTTTTAG -3'

Sequencing Primer
(F):5'- TGGGCCATTTCAAAGGAAACC -3'
(R):5'- CTAGTTTTTCACTCCTTGGAG -3'
Posted On 2014-06-23