Incidental Mutation 'R1793:Eif4g3'
ID201908
Institutional Source Beutler Lab
Gene Symbol Eif4g3
Ensembl Gene ENSMUSG00000028760
Gene Nameeukaryotic translation initiation factor 4 gamma, 3
Synonyms1500002J22Rik, repro8, G1-419-52, 4930523M17Rik, eIF4GII
MMRRC Submission 039823-MU
Accession Numbers

Genbank: NM_172703; MGI: 1923935

Is this an essential gene? Possibly non essential (E-score: 0.396) question?
Stock #R1793 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location137993022-138208508 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138171131 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1071 (I1071T)
Ref Sequence ENSEMBL: ENSMUSP00000145147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084214] [ENSMUST00000084215] [ENSMUST00000105831] [ENSMUST00000140796] [ENSMUST00000203828]
Predicted Effect probably damaging
Transcript: ENSMUST00000084214
AA Change: I906T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081232
Gene: ENSMUSG00000028760
AA Change: I906T

DomainStartEndE-ValueType
low complexity region 24 43 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
low complexity region 147 152 N/A INTRINSIC
PDB:1LJ2|D 154 179 8e-9 PDB
low complexity region 192 207 N/A INTRINSIC
low complexity region 269 310 N/A INTRINSIC
low complexity region 427 444 N/A INTRINSIC
low complexity region 534 550 N/A INTRINSIC
low complexity region 579 588 N/A INTRINSIC
low complexity region 592 616 N/A INTRINSIC
Blast:MIF4G 617 708 5e-49 BLAST
Blast:MIF4G 722 765 5e-16 BLAST
MIF4G 768 996 1.42e-65 SMART
low complexity region 1086 1109 N/A INTRINSIC
MA3 1215 1327 9.29e-38 SMART
eIF5C 1487 1574 7.92e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000084215
AA Change: I888T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000081233
Gene: ENSMUSG00000028760
AA Change: I888T

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 75 102 N/A INTRINSIC
low complexity region 129 134 N/A INTRINSIC
PDB:1LJ2|D 136 161 8e-9 PDB
low complexity region 174 189 N/A INTRINSIC
low complexity region 251 292 N/A INTRINSIC
low complexity region 409 426 N/A INTRINSIC
low complexity region 516 532 N/A INTRINSIC
low complexity region 561 570 N/A INTRINSIC
low complexity region 574 598 N/A INTRINSIC
Blast:MIF4G 599 690 4e-49 BLAST
Blast:MIF4G 704 747 5e-16 BLAST
MIF4G 750 978 1.42e-65 SMART
low complexity region 1068 1113 N/A INTRINSIC
MA3 1216 1328 9.29e-38 SMART
eIF5C 1488 1575 7.92e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105831
AA Change: I895T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101457
Gene: ENSMUSG00000028760
AA Change: I895T

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
low complexity region 82 109 N/A INTRINSIC
low complexity region 136 141 N/A INTRINSIC
PDB:1LJ2|D 143 168 8e-9 PDB
low complexity region 181 196 N/A INTRINSIC
low complexity region 258 299 N/A INTRINSIC
low complexity region 416 433 N/A INTRINSIC
low complexity region 523 539 N/A INTRINSIC
low complexity region 568 577 N/A INTRINSIC
low complexity region 581 605 N/A INTRINSIC
Blast:MIF4G 606 697 4e-49 BLAST
Blast:MIF4G 711 754 5e-16 BLAST
MIF4G 757 985 1.42e-65 SMART
low complexity region 1075 1098 N/A INTRINSIC
MA3 1204 1316 9.29e-38 SMART
eIF5C 1476 1563 7.92e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000140796
AA Change: I330T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115946
Gene: ENSMUSG00000028760
AA Change: I330T

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
low complexity region 16 40 N/A INTRINSIC
Blast:MIF4G 41 132 2e-49 BLAST
Blast:MIF4G 146 189 3e-16 BLAST
MIF4G 192 420 1.42e-65 SMART
low complexity region 510 533 N/A INTRINSIC
MA3 639 751 9.29e-38 SMART
eIF5C 911 998 7.92e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203828
AA Change: I1071T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145147
Gene: ENSMUSG00000028760
AA Change: I1071T

DomainStartEndE-ValueType
low complexity region 41 81 N/A INTRINSIC
low complexity region 193 208 N/A INTRINSIC
low complexity region 258 285 N/A INTRINSIC
low complexity region 312 317 N/A INTRINSIC
PDB:1LJ2|D 319 344 9e-9 PDB
low complexity region 357 372 N/A INTRINSIC
low complexity region 434 475 N/A INTRINSIC
low complexity region 592 609 N/A INTRINSIC
low complexity region 699 715 N/A INTRINSIC
low complexity region 744 753 N/A INTRINSIC
low complexity region 757 781 N/A INTRINSIC
Blast:MIF4G 782 873 9e-49 BLAST
Blast:MIF4G 887 930 5e-16 BLAST
MIF4G 933 1161 6e-68 SMART
coiled coil region 1174 1201 N/A INTRINSIC
low complexity region 1251 1296 N/A INTRINSIC
MA3 1399 1511 3.9e-40 SMART
eIF5C 1671 1758 3.9e-38 SMART
Meta Mutation Damage Score 0.7352 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency 100% (122/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be part of the eIF4F protein complex, which is involved in mRNA cap recognition and transport of mRNAs to the ribosome. Interestingly, a microRNA (miR-520c-3p) has been found that negatively regulates synthesis of the encoded protein, and this leads to a global decrease in protein translation and cell proliferation. Therefore, this protein is a key component of the anti-tumor activity of miR-520c-3p. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for an ENU induced allele exhibit decreased testes weight, azoospermia, and arrested male meiosis. Mice homozygous for a gene trapped allele exhibit small testes. [provided by MGI curators]
Allele List at MGI

All alleles(27) : Gene trapped(27)

Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,278 H571Q probably damaging Het
Abcf2 T A 5: 24,568,776 M372L probably benign Het
Acaca A C 11: 84,315,969 T1552P probably damaging Het
Acaca A G 11: 84,338,393 D1682G probably damaging Het
Acvr1b T C 15: 101,194,025 V62A probably benign Het
Aimp1 C T 3: 132,674,064 V97M probably benign Het
Aldh1l1 C T 6: 90,577,831 T557I possibly damaging Het
Alpk1 T C 3: 127,677,798 T1012A probably damaging Het
Amot G A X: 145,450,589 probably benign Het
Arap1 T A 7: 101,388,622 H477Q probably benign Het
Arhgap18 T A 10: 26,860,736 probably benign Het
Arhgef10l C T 4: 140,515,373 V862M probably damaging Het
Arl4d A G 11: 101,666,728 I27V probably benign Het
Asb18 G A 1: 90,014,555 P8L probably damaging Het
Ash1l A G 3: 89,070,309 H2682R probably damaging Het
Aspm T A 1: 139,457,341 V241E probably benign Het
Atf7ip G T 6: 136,609,219 probably benign Het
AY358078 T G 14: 51,804,594 M142R unknown Het
C3 T A 17: 57,219,592 K796N possibly damaging Het
Cd3eap T C 7: 19,357,979 T68A possibly damaging Het
Ceacam16 T C 7: 19,856,116 T301A probably damaging Het
Ceacam5 T G 7: 17,747,395 Y356D probably benign Het
Cep192 C T 18: 67,851,767 A1616V possibly damaging Het
Cherp A T 8: 72,463,150 H645Q probably benign Het
CK137956 T C 4: 127,951,449 D167G probably benign Het
Clcn1 T A 6: 42,298,926 probably null Het
Cntn1 C T 15: 92,291,671 T625I possibly damaging Het
Cpn2 T A 16: 30,259,324 N520Y probably damaging Het
Crocc G A 4: 141,019,309 R1762W probably damaging Het
Cts3 C A 13: 61,568,153 V100F probably benign Het
Ddx56 A T 11: 6,266,934 V87D probably damaging Het
Dnah9 C T 11: 66,119,594 probably null Het
Dock1 T A 7: 135,098,727 probably null Het
Dst T A 1: 34,152,471 Y291* probably null Het
Fblim1 T C 4: 141,595,238 Q78R probably damaging Het
Fcamr C T 1: 130,811,547 P195S probably benign Het
Fcho1 G A 8: 71,709,022 Q835* probably null Het
Frem3 A G 8: 80,613,112 N678S probably benign Het
Frk G A 10: 34,607,882 R413H probably benign Het
Gm10619 C A 7: 73,810,010 noncoding transcript Het
Gm12185 G A 11: 48,915,756 R203* probably null Het
Gm12886 A G 4: 121,422,977 V34A probably benign Het
Gna12 A T 5: 140,760,952 I246N probably damaging Het
Gpm6a T C 8: 55,054,832 M201T probably benign Het
Gpsm2 T G 3: 108,700,909 D220A probably benign Het
Grip2 C G 6: 91,783,642 V325L probably benign Het
Grk5 C A 19: 61,076,762 A288D probably damaging Het
Herpud2 G A 9: 25,110,657 A231V possibly damaging Het
Hmcn1 T C 1: 150,749,083 S1024G probably benign Het
Hp1bp3 A G 4: 138,230,509 D295G probably damaging Het
Igsf21 T C 4: 140,034,392 H325R probably damaging Het
Ing2 T A 8: 47,669,329 L61F probably damaging Het
Jak3 T C 8: 71,685,946 probably benign Het
Kcnn3 T A 3: 89,609,405 C374S probably benign Het
Klk1b22 A G 7: 44,116,351 probably benign Het
Larp1 T C 11: 58,049,938 M630T possibly damaging Het
Lhx5 T A 5: 120,434,660 C115S probably damaging Het
Lmcd1 C A 6: 112,328,751 T271K probably benign Het
Lpar1 G A 4: 58,486,798 R158* probably null Het
Lyst T A 13: 13,647,083 C1347* probably null Het
Maats1 T A 16: 38,321,419 N384Y possibly damaging Het
Map3k8 G A 18: 4,332,389 Q441* probably null Het
Mboat1 T C 13: 30,219,650 V144A probably damaging Het
Mcur1 C T 13: 43,560,015 G38S unknown Het
Med13 T A 11: 86,329,351 M276L probably benign Het
Mefv A G 16: 3,708,664 S699P possibly damaging Het
Mfsd4a C A 1: 132,059,339 A62S probably damaging Het
Mmp27 A G 9: 7,571,458 M1V probably null Het
Myo1c C T 11: 75,657,589 T58I probably damaging Het
Myom3 A T 4: 135,810,755 D1316V probably benign Het
Naa25 T A 5: 121,417,415 C235S possibly damaging Het
Naa25 C A 5: 121,420,593 R333S probably damaging Het
Nav3 G A 10: 109,703,372 T2056I probably benign Het
Nol4 A G 18: 22,769,821 Y378H probably damaging Het
Npat G A 9: 53,552,289 R124Q probably damaging Het
Npr3 T A 15: 11,848,579 E434V probably benign Het
Nptx2 A G 5: 144,548,320 T208A probably benign Het
Obscn C T 11: 59,077,780 V2798M probably damaging Het
Olfr1406 A T 1: 173,184,409 H8Q probably benign Het
Olfr1484 C T 19: 13,585,415 T37I probably benign Het
Olfr569 A G 7: 102,888,043 Y37H probably benign Het
Padi1 G A 4: 140,814,656 P652S probably damaging Het
Pcdh1 G T 18: 38,198,885 P355Q probably damaging Het
Pck2 G A 14: 55,543,965 R189H possibly damaging Het
Pcsk5 T A 19: 17,454,750 K1500N possibly damaging Het
Phc3 A T 3: 30,948,716 S218T probably damaging Het
Piezo2 T A 18: 63,106,284 M510L possibly damaging Het
Ppp1r3a A T 6: 14,754,718 Y177N probably damaging Het
Psme2b A T 11: 48,945,534 D195E probably damaging Het
Ptprr T C 10: 116,252,922 V463A probably damaging Het
Pwwp2b G A 7: 139,256,365 R574Q probably damaging Het
Rap1gds1 T A 3: 139,050,553 T14S possibly damaging Het
Rbm11 A T 16: 75,600,797 K205M probably damaging Het
Rfx1 T A 8: 84,066,421 probably benign Het
Rnasel C A 1: 153,754,423 H228Q probably damaging Het
Sap130 T A 18: 31,698,587 I710K probably benign Het
Slc27a4 C A 2: 29,805,721 D89E probably benign Het
Spata31d1b T C 13: 59,715,965 V309A probably benign Het
Syt7 T G 19: 10,443,990 Y420D probably damaging Het
Tanc2 A G 11: 105,625,033 probably null Het
Tbc1d10b A G 7: 127,203,758 S333P possibly damaging Het
Tenm2 G A 11: 36,023,382 P2442S probably damaging Het
Tenm3 C T 8: 48,674,544 C33Y probably damaging Het
Timmdc1 A G 16: 38,499,057 L245P possibly damaging Het
Tlr5 T C 1: 182,972,447 F5L probably benign Het
Ttc25 C A 11: 100,569,853 probably null Het
Ttll4 T A 1: 74,687,840 F784L possibly damaging Het
Tulp4 A G 17: 6,139,112 T70A possibly damaging Het
Txndc17 T A 11: 72,208,745 N81K probably benign Het
Ubr3 C T 2: 70,000,551 probably benign Het
Uri1 A C 7: 37,981,691 V96G probably damaging Het
Uspl1 T A 5: 149,213,436 I482N probably damaging Het
Vmn1r229 A G 17: 20,814,712 N73S possibly damaging Het
Vwa7 G T 17: 35,024,412 G689* probably null Het
Zfp114 T A 7: 24,177,739 probably null Het
Zfp618 A G 4: 63,133,237 S659G probably damaging Het
Zfp872 A G 9: 22,200,053 K275R probably damaging Het
Zzef1 C T 11: 72,886,709 P1789S probably damaging Het
Other mutations in Eif4g3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01817:Eif4g3 APN 4 138120362 missense probably benign 0.01
IGL02171:Eif4g3 APN 4 138126589 missense probably benign 0.03
IGL02487:Eif4g3 APN 4 138203378 missense possibly damaging 0.92
IGL02514:Eif4g3 APN 4 138126194 missense possibly damaging 0.87
IGL02622:Eif4g3 APN 4 138097366 splice site probably benign
IGL02725:Eif4g3 APN 4 138170471 splice site probably benign
IGL02735:Eif4g3 APN 4 138126211 missense probably benign 0.40
IGL03008:Eif4g3 APN 4 138120388 missense probably damaging 1.00
IGL03077:Eif4g3 APN 4 138125855 missense probably damaging 1.00
N/A - 535:Eif4g3 UTSW 4 138120428 missense probably damaging 0.98
R0013:Eif4g3 UTSW 4 138175848 missense possibly damaging 0.88
R0193:Eif4g3 UTSW 4 138146376 splice site probably benign
R0240:Eif4g3 UTSW 4 138170562 missense probably damaging 0.98
R0240:Eif4g3 UTSW 4 138170562 missense probably damaging 0.98
R0563:Eif4g3 UTSW 4 138175840 splice site probably benign
R0841:Eif4g3 UTSW 4 138165818 missense probably damaging 1.00
R0884:Eif4g3 UTSW 4 138151776 missense possibly damaging 0.76
R1116:Eif4g3 UTSW 4 138091775 critical splice donor site probably null
R1145:Eif4g3 UTSW 4 138165818 missense probably damaging 1.00
R1145:Eif4g3 UTSW 4 138165818 missense probably damaging 1.00
R1192:Eif4g3 UTSW 4 138171186 missense probably damaging 1.00
R1401:Eif4g3 UTSW 4 138206084 missense probably damaging 0.99
R1535:Eif4g3 UTSW 4 138097302 missense probably damaging 1.00
R1571:Eif4g3 UTSW 4 138120408 missense probably damaging 1.00
R1576:Eif4g3 UTSW 4 138096870 missense probably damaging 0.99
R1607:Eif4g3 UTSW 4 138126563 missense probably benign 0.00
R1618:Eif4g3 UTSW 4 138206058 missense probably damaging 1.00
R1823:Eif4g3 UTSW 4 138180491 missense probably benign 0.37
R1857:Eif4g3 UTSW 4 138175876 missense possibly damaging 0.67
R1907:Eif4g3 UTSW 4 138158415 missense probably damaging 1.00
R2041:Eif4g3 UTSW 4 138105306 splice site probably benign
R2106:Eif4g3 UTSW 4 138082919 start gained probably benign
R2124:Eif4g3 UTSW 4 138184742 missense probably damaging 1.00
R2301:Eif4g3 UTSW 4 138172659 missense probably damaging 1.00
R2519:Eif4g3 UTSW 4 138097318 missense probably benign 0.37
R3033:Eif4g3 UTSW 4 138103410 missense probably damaging 1.00
R3870:Eif4g3 UTSW 4 138096900 missense probably damaging 0.98
R4542:Eif4g3 UTSW 4 138203417 missense probably damaging 0.99
R4582:Eif4g3 UTSW 4 138171245 missense probably damaging 1.00
R4607:Eif4g3 UTSW 4 138126458 missense probably benign 0.03
R4608:Eif4g3 UTSW 4 138126458 missense probably benign 0.03
R4658:Eif4g3 UTSW 4 138206132 missense probably damaging 1.00
R4736:Eif4g3 UTSW 4 138198097 missense probably benign 0.01
R4739:Eif4g3 UTSW 4 138183199 missense possibly damaging 0.79
R4739:Eif4g3 UTSW 4 138198097 missense probably benign 0.01
R4740:Eif4g3 UTSW 4 138198097 missense probably benign 0.01
R4760:Eif4g3 UTSW 4 138084318 missense possibly damaging 0.46
R4825:Eif4g3 UTSW 4 138194081 missense probably benign
R4826:Eif4g3 UTSW 4 138177945 missense possibly damaging 0.95
R4941:Eif4g3 UTSW 4 138170565 missense probably damaging 1.00
R5040:Eif4g3 UTSW 4 138096889 missense probably damaging 0.99
R5070:Eif4g3 UTSW 4 138146299 missense probably benign 0.00
R5155:Eif4g3 UTSW 4 138126743 missense probably benign 0.36
R5226:Eif4g3 UTSW 4 138096794 missense possibly damaging 0.93
R5229:Eif4g3 UTSW 4 138096794 missense possibly damaging 0.93
R5303:Eif4g3 UTSW 4 138126562 missense probably benign 0.04
R5369:Eif4g3 UTSW 4 138183334 missense possibly damaging 0.87
R5394:Eif4g3 UTSW 4 138103398 splice site probably null
R5665:Eif4g3 UTSW 4 138126589 missense probably benign 0.03
R5678:Eif4g3 UTSW 4 138151742 missense probably damaging 0.99
R5695:Eif4g3 UTSW 4 138163433 splice site probably null
R5704:Eif4g3 UTSW 4 138190692 missense probably damaging 1.00
R5924:Eif4g3 UTSW 4 138201926 missense probably damaging 1.00
R6214:Eif4g3 UTSW 4 138058003 missense probably damaging 0.99
R6278:Eif4g3 UTSW 4 138188083 missense possibly damaging 0.82
R6519:Eif4g3 UTSW 4 137994008 missense probably benign
R6659:Eif4g3 UTSW 4 138177932 missense probably damaging 1.00
R6720:Eif4g3 UTSW 4 138175832 splice site probably null
R6812:Eif4g3 UTSW 4 138103376 missense probably damaging 1.00
R6922:Eif4g3 UTSW 4 138097335 missense probably damaging 1.00
R7175:Eif4g3 UTSW 4 138126215 missense probably damaging 1.00
R7176:Eif4g3 UTSW 4 138171186 missense probably damaging 1.00
R7598:Eif4g3 UTSW 4 138194124 missense probably benign 0.02
R7618:Eif4g3 UTSW 4 138171118 missense probably damaging 1.00
R7805:Eif4g3 UTSW 4 138146354 missense probably benign 0.00
R7935:Eif4g3 UTSW 4 138096771 missense probably damaging 1.00
R7983:Eif4g3 UTSW 4 138151593 missense probably benign 0.00
R8261:Eif4g3 UTSW 4 138171118 missense possibly damaging 0.46
R8371:Eif4g3 UTSW 4 138096845 missense probably damaging 1.00
R8499:Eif4g3 UTSW 4 138165928 missense probably damaging 1.00
R8670:Eif4g3 UTSW 4 138158512 critical splice donor site probably null
R8672:Eif4g3 UTSW 4 138126512 missense possibly damaging 0.75
R8744:Eif4g3 UTSW 4 137994061 small deletion probably benign
R8767:Eif4g3 UTSW 4 138203468 missense probably damaging 0.99
R8771:Eif4g3 UTSW 4 138180537 nonsense probably null
RF008:Eif4g3 UTSW 4 138175924 missense probably damaging 0.98
X0067:Eif4g3 UTSW 4 138163619 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTTGTCAGAGCATTTGAGC -3'
(R):5'- TCACATGTGCCATGAGGAGG -3'

Sequencing Primer
(F):5'- TCAGAGCATTTGAGCCCCGAAG -3'
(R):5'- ACTGCTCCAACAGGGGTAG -3'
Posted On2014-06-23