Mutagenetix > Incidental Mutation

Incidental Mutation 'R1793:Eif4g3'

201908

Institutional Source

Beutler Lab

Gene Symbol

Eif4g3

Ensembl Gene

ENSMUSG00000028760

Gene Name

eukaryotic translation initiation factor 4 gamma, 3

Synonyms

1500002J22Rik, repro8, G1-419-52, 4930523M17Rik, eIF4GII

MMRRC Submission

039823-MU

Accession Numbers

Genbank: NM_172703; MGI: 1923935

Is this an essential gene?

Possibly non essential (E-score: 0.267) question?

Stock #

R1793 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

137993022-138208508 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 138171131 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1071 (I1071T)

Ref Sequence

ENSEMBL: ENSMUSP00000145147 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084214] [ENSMUST00000084215] [ENSMUST00000105831] [ENSMUST00000140796] [ENSMUST00000203828]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000084214
AA Change: I906T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000081232
Gene: ENSMUSG00000028760
AA Change: I906T

Domain	Start	End	E-Value	Type
low complexity region	24	43	N/A	INTRINSIC
low complexity region	93	120	N/A	INTRINSIC
low complexity region	147	152	N/A	INTRINSIC
PDB:1LJ2\|D	154	179	8e-9	PDB
low complexity region	192	207	N/A	INTRINSIC
low complexity region	269	310	N/A	INTRINSIC
low complexity region	427	444	N/A	INTRINSIC
low complexity region	534	550	N/A	INTRINSIC
low complexity region	579	588	N/A	INTRINSIC
low complexity region	592	616	N/A	INTRINSIC
Blast:MIF4G	617	708	5e-49	BLAST
Blast:MIF4G	722	765	5e-16	BLAST
MIF4G	768	996	1.42e-65	SMART
low complexity region	1086	1109	N/A	INTRINSIC
MA3	1215	1327	9.29e-38	SMART
eIF5C	1487	1574	7.92e-36	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000084215
AA Change: I888T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000081233
Gene: ENSMUSG00000028760
AA Change: I888T

Domain	Start	End	E-Value	Type
low complexity region	10	25	N/A	INTRINSIC
low complexity region	75	102	N/A	INTRINSIC
low complexity region	129	134	N/A	INTRINSIC
PDB:1LJ2\|D	136	161	8e-9	PDB
low complexity region	174	189	N/A	INTRINSIC
low complexity region	251	292	N/A	INTRINSIC
low complexity region	409	426	N/A	INTRINSIC
low complexity region	516	532	N/A	INTRINSIC
low complexity region	561	570	N/A	INTRINSIC
low complexity region	574	598	N/A	INTRINSIC
Blast:MIF4G	599	690	4e-49	BLAST
Blast:MIF4G	704	747	5e-16	BLAST
MIF4G	750	978	1.42e-65	SMART
low complexity region	1068	1113	N/A	INTRINSIC
MA3	1216	1328	9.29e-38	SMART
eIF5C	1488	1575	7.92e-36	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105831
AA Change: I895T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101457
Gene: ENSMUSG00000028760
AA Change: I895T

Domain	Start	End	E-Value	Type
low complexity region	14	32	N/A	INTRINSIC
low complexity region	82	109	N/A	INTRINSIC
low complexity region	136	141	N/A	INTRINSIC
PDB:1LJ2\|D	143	168	8e-9	PDB
low complexity region	181	196	N/A	INTRINSIC
low complexity region	258	299	N/A	INTRINSIC
low complexity region	416	433	N/A	INTRINSIC
low complexity region	523	539	N/A	INTRINSIC
low complexity region	568	577	N/A	INTRINSIC
low complexity region	581	605	N/A	INTRINSIC
Blast:MIF4G	606	697	4e-49	BLAST
Blast:MIF4G	711	754	5e-16	BLAST
MIF4G	757	985	1.42e-65	SMART
low complexity region	1075	1098	N/A	INTRINSIC
MA3	1204	1316	9.29e-38	SMART
eIF5C	1476	1563	7.92e-36	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000140796
AA Change: I330T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000115946
Gene: ENSMUSG00000028760
AA Change: I330T

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
low complexity region	16	40	N/A	INTRINSIC
Blast:MIF4G	41	132	2e-49	BLAST
Blast:MIF4G	146	189	3e-16	BLAST
MIF4G	192	420	1.42e-65	SMART
low complexity region	510	533	N/A	INTRINSIC
MA3	639	751	9.29e-38	SMART
eIF5C	911	998	7.92e-36	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000203828
AA Change: I1071T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000145147
Gene: ENSMUSG00000028760
AA Change: I1071T

Domain	Start	End	E-Value	Type
low complexity region	41	81	N/A	INTRINSIC
low complexity region	193	208	N/A	INTRINSIC
low complexity region	258	285	N/A	INTRINSIC
low complexity region	312	317	N/A	INTRINSIC
PDB:1LJ2\|D	319	344	9e-9	PDB
low complexity region	357	372	N/A	INTRINSIC
low complexity region	434	475	N/A	INTRINSIC
low complexity region	592	609	N/A	INTRINSIC
low complexity region	699	715	N/A	INTRINSIC
low complexity region	744	753	N/A	INTRINSIC
low complexity region	757	781	N/A	INTRINSIC
Blast:MIF4G	782	873	9e-49	BLAST
Blast:MIF4G	887	930	5e-16	BLAST
MIF4G	933	1161	6e-68	SMART
coiled coil region	1174	1201	N/A	INTRINSIC
low complexity region	1251	1296	N/A	INTRINSIC
MA3	1399	1511	3.9e-40	SMART
eIF5C	1671	1758	3.9e-38	SMART

Meta Mutation Damage Score

0.7352

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.9%

Validation Efficiency

100% (122/122)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be part of the eIF4F protein complex, which is involved in mRNA cap recognition and transport of mRNAs to the ribosome. Interestingly, a microRNA (miR-520c-3p) has been found that negatively regulates synthesis of the encoded protein, and this leads to a global decrease in protein translation and cell proliferation. Therefore, this protein is a key component of the anti-tumor activity of miR-520c-3p. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for an ENU induced allele exhibit decreased testes weight, azoospermia, and arrested male meiosis. Mice homozygous for a gene trapped allele exhibit small testes. [provided by MGI curators]

Allele List at MGI

All alleles(27) : Gene trapped(27)

Other mutations in this stock

Total: 118 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,736,278	H571Q	probably damaging	Het
Abcf2	T	A	5: 24,568,776	M372L	probably benign	Het
Acaca	A	C	11: 84,315,969	T1552P	probably damaging	Het
Acaca	A	G	11: 84,338,393	D1682G	probably damaging	Het
Acvr1b	T	C	15: 101,194,025	V62A	probably benign	Het
Aimp1	C	T	3: 132,674,064	V97M	probably benign	Het
Aldh1l1	C	T	6: 90,577,831	T557I	possibly damaging	Het
Alpk1	T	C	3: 127,677,798	T1012A	probably damaging	Het
Amot	G	A	X: 145,450,589		probably benign	Het
Arap1	T	A	7: 101,388,622	H477Q	probably benign	Het
Arhgap18	T	A	10: 26,860,736		probably benign	Het
Arhgef10l	C	T	4: 140,515,373	V862M	probably damaging	Het
Arl4d	A	G	11: 101,666,728	I27V	probably benign	Het
Asb18	G	A	1: 90,014,555	P8L	probably damaging	Het
Ash1l	A	G	3: 89,070,309	H2682R	probably damaging	Het
Aspm	T	A	1: 139,457,341	V241E	probably benign	Het
Atf7ip	G	T	6: 136,609,219		probably benign	Het
AY358078	T	G	14: 51,804,594	M142R	unknown	Het
C3	T	A	17: 57,219,592	K796N	possibly damaging	Het
Cd3eap	T	C	7: 19,357,979	T68A	possibly damaging	Het
Ceacam16	T	C	7: 19,856,116	T301A	probably damaging	Het
Ceacam5	T	G	7: 17,747,395	Y356D	probably benign	Het
Cep192	C	T	18: 67,851,767	A1616V	possibly damaging	Het
Cherp	A	T	8: 72,463,150	H645Q	probably benign	Het
CK137956	T	C	4: 127,951,449	D167G	probably benign	Het
Clcn1	T	A	6: 42,298,926		probably null	Het
Cntn1	C	T	15: 92,291,671	T625I	possibly damaging	Het
Cpn2	T	A	16: 30,259,324	N520Y	probably damaging	Het
Crocc	G	A	4: 141,019,309	R1762W	probably damaging	Het
Cts3	C	A	13: 61,568,153	V100F	probably benign	Het
Ddx56	A	T	11: 6,266,934	V87D	probably damaging	Het
Dnah9	C	T	11: 66,119,594		probably null	Het
Dock1	T	A	7: 135,098,727		probably null	Het
Dst	T	A	1: 34,152,471	Y291*	probably null	Het
Fblim1	T	C	4: 141,595,238	Q78R	probably damaging	Het
Fcamr	C	T	1: 130,811,547	P195S	probably benign	Het
Fcho1	G	A	8: 71,709,022	Q835*	probably null	Het
Frem3	A	G	8: 80,613,112	N678S	probably benign	Het
Frk	G	A	10: 34,607,882	R413H	probably benign	Het
Gm10619	C	A	7: 73,810,010		noncoding transcript	Het
Gm12185	G	A	11: 48,915,756	R203*	probably null	Het
Gm12886	A	G	4: 121,422,977	V34A	probably benign	Het
Gna12	A	T	5: 140,760,952	I246N	probably damaging	Het
Gpm6a	T	C	8: 55,054,832	M201T	probably benign	Het
Gpsm2	T	G	3: 108,700,909	D220A	probably benign	Het
Grip2	C	G	6: 91,783,642	V325L	probably benign	Het
Grk5	C	A	19: 61,076,762	A288D	probably damaging	Het
Herpud2	G	A	9: 25,110,657	A231V	possibly damaging	Het
Hmcn1	T	C	1: 150,749,083	S1024G	probably benign	Het
Hp1bp3	A	G	4: 138,230,509	D295G	probably damaging	Het
Igsf21	T	C	4: 140,034,392	H325R	probably damaging	Het
Ing2	T	A	8: 47,669,329	L61F	probably damaging	Het
Jak3	T	C	8: 71,685,946		probably benign	Het
Kcnn3	T	A	3: 89,609,405	C374S	probably benign	Het
Klk1b22	A	G	7: 44,116,351		probably benign	Het
Larp1	T	C	11: 58,049,938	M630T	possibly damaging	Het
Lhx5	T	A	5: 120,434,660	C115S	probably damaging	Het
Lmcd1	C	A	6: 112,328,751	T271K	probably benign	Het
Lpar1	G	A	4: 58,486,798	R158*	probably null	Het
Lyst	T	A	13: 13,647,083	C1347*	probably null	Het
Maats1	T	A	16: 38,321,419	N384Y	possibly damaging	Het
Map3k8	G	A	18: 4,332,389	Q441*	probably null	Het
Mboat1	T	C	13: 30,219,650	V144A	probably damaging	Het
Mcur1	C	T	13: 43,560,015	G38S	unknown	Het
Med13	T	A	11: 86,329,351	M276L	probably benign	Het
Mefv	A	G	16: 3,708,664	S699P	possibly damaging	Het
Mfsd4a	C	A	1: 132,059,339	A62S	probably damaging	Het
Mmp27	A	G	9: 7,571,458	M1V	probably null	Het
Myo1c	C	T	11: 75,657,589	T58I	probably damaging	Het
Myom3	A	T	4: 135,810,755	D1316V	probably benign	Het
Naa25	T	A	5: 121,417,415	C235S	possibly damaging	Het
Naa25	C	A	5: 121,420,593	R333S	probably damaging	Het
Nav3	G	A	10: 109,703,372	T2056I	probably benign	Het
Nol4	A	G	18: 22,769,821	Y378H	probably damaging	Het
Npat	G	A	9: 53,552,289	R124Q	probably damaging	Het
Npr3	T	A	15: 11,848,579	E434V	probably benign	Het
Nptx2	A	G	5: 144,548,320	T208A	probably benign	Het
Obscn	C	T	11: 59,077,780	V2798M	probably damaging	Het
Olfr1406	A	T	1: 173,184,409	H8Q	probably benign	Het
Olfr1484	C	T	19: 13,585,415	T37I	probably benign	Het
Olfr569	A	G	7: 102,888,043	Y37H	probably benign	Het
Padi1	G	A	4: 140,814,656	P652S	probably damaging	Het
Pcdh1	G	T	18: 38,198,885	P355Q	probably damaging	Het
Pck2	G	A	14: 55,543,965	R189H	possibly damaging	Het
Pcsk5	T	A	19: 17,454,750	K1500N	possibly damaging	Het
Phc3	A	T	3: 30,948,716	S218T	probably damaging	Het
Piezo2	T	A	18: 63,106,284	M510L	possibly damaging	Het
Ppp1r3a	A	T	6: 14,754,718	Y177N	probably damaging	Het
Psme2b	A	T	11: 48,945,534	D195E	probably damaging	Het
Ptprr	T	C	10: 116,252,922	V463A	probably damaging	Het
Pwwp2b	G	A	7: 139,256,365	R574Q	probably damaging	Het
Rap1gds1	T	A	3: 139,050,553	T14S	possibly damaging	Het
Rbm11	A	T	16: 75,600,797	K205M	probably damaging	Het
Rfx1	T	A	8: 84,066,421		probably benign	Het
Rnasel	C	A	1: 153,754,423	H228Q	probably damaging	Het
Sap130	T	A	18: 31,698,587	I710K	probably benign	Het
Slc27a4	C	A	2: 29,805,721	D89E	probably benign	Het
Spata31d1b	T	C	13: 59,715,965	V309A	probably benign	Het
Syt7	T	G	19: 10,443,990	Y420D	probably damaging	Het
Tanc2	A	G	11: 105,625,033		probably null	Het
Tbc1d10b	A	G	7: 127,203,758	S333P	possibly damaging	Het
Tenm2	G	A	11: 36,023,382	P2442S	probably damaging	Het
Tenm3	C	T	8: 48,674,544	C33Y	probably damaging	Het
Timmdc1	A	G	16: 38,499,057	L245P	possibly damaging	Het
Tlr5	T	C	1: 182,972,447	F5L	probably benign	Het
Ttc25	C	A	11: 100,569,853		probably null	Het
Ttll4	T	A	1: 74,687,840	F784L	possibly damaging	Het
Tulp4	A	G	17: 6,139,112	T70A	possibly damaging	Het
Txndc17	T	A	11: 72,208,745	N81K	probably benign	Het
Ubr3	C	T	2: 70,000,551		probably benign	Het
Uri1	A	C	7: 37,981,691	V96G	probably damaging	Het
Uspl1	T	A	5: 149,213,436	I482N	probably damaging	Het
Vmn1r229	A	G	17: 20,814,712	N73S	possibly damaging	Het
Vwa7	G	T	17: 35,024,412	G689*	probably null	Het
Zfp114	T	A	7: 24,177,739		probably null	Het
Zfp618	A	G	4: 63,133,237	S659G	probably damaging	Het
Zfp872	A	G	9: 22,200,053	K275R	probably damaging	Het
Zzef1	C	T	11: 72,886,709	P1789S	probably damaging	Het

Other mutations in Eif4g3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01817:Eif4g3	APN	4	138120362	missense	probably benign	0.01
IGL02171:Eif4g3	APN	4	138126589	missense	probably benign	0.03
IGL02487:Eif4g3	APN	4	138203378	missense	possibly damaging	0.92
IGL02514:Eif4g3	APN	4	138126194	missense	possibly damaging	0.87
IGL02622:Eif4g3	APN	4	138097366	splice site	probably benign
IGL02725:Eif4g3	APN	4	138170471	splice site	probably benign
IGL02735:Eif4g3	APN	4	138126211	missense	probably benign	0.40
IGL03008:Eif4g3	APN	4	138120388	missense	probably damaging	1.00
IGL03077:Eif4g3	APN	4	138125855	missense	probably damaging	1.00
N/A - 535:Eif4g3	UTSW	4	138120428	missense	probably damaging	0.98
R0013:Eif4g3	UTSW	4	138175848	missense	possibly damaging	0.88
R0193:Eif4g3	UTSW	4	138146376	splice site	probably benign
R0240:Eif4g3	UTSW	4	138170562	missense	probably damaging	0.98
R0240:Eif4g3	UTSW	4	138170562	missense	probably damaging	0.98
R0563:Eif4g3	UTSW	4	138175840	splice site	probably benign
R0841:Eif4g3	UTSW	4	138165818	missense	probably damaging	1.00
R0884:Eif4g3	UTSW	4	138151776	missense	possibly damaging	0.76
R1116:Eif4g3	UTSW	4	138091775	critical splice donor site	probably null
R1145:Eif4g3	UTSW	4	138165818	missense	probably damaging	1.00
R1145:Eif4g3	UTSW	4	138165818	missense	probably damaging	1.00
R1192:Eif4g3	UTSW	4	138171186	missense	probably damaging	1.00
R1401:Eif4g3	UTSW	4	138206084	missense	probably damaging	0.99
R1535:Eif4g3	UTSW	4	138097302	missense	probably damaging	1.00
R1571:Eif4g3	UTSW	4	138120408	missense	probably damaging	1.00
R1576:Eif4g3	UTSW	4	138096870	missense	probably damaging	0.99
R1607:Eif4g3	UTSW	4	138126563	missense	probably benign	0.00
R1618:Eif4g3	UTSW	4	138206058	missense	probably damaging	1.00
R1823:Eif4g3	UTSW	4	138180491	missense	probably benign	0.37
R1857:Eif4g3	UTSW	4	138175876	missense	possibly damaging	0.67
R1907:Eif4g3	UTSW	4	138158415	missense	probably damaging	1.00
R2041:Eif4g3	UTSW	4	138105306	splice site	probably benign
R2106:Eif4g3	UTSW	4	138082919	start gained	probably benign
R2124:Eif4g3	UTSW	4	138184742	missense	probably damaging	1.00
R2301:Eif4g3	UTSW	4	138172659	missense	probably damaging	1.00
R2519:Eif4g3	UTSW	4	138097318	missense	probably benign	0.37
R3033:Eif4g3	UTSW	4	138103410	missense	probably damaging	1.00
R3870:Eif4g3	UTSW	4	138096900	missense	probably damaging	0.98
R4542:Eif4g3	UTSW	4	138203417	missense	probably damaging	0.99
R4582:Eif4g3	UTSW	4	138171245	missense	probably damaging	1.00
R4607:Eif4g3	UTSW	4	138126458	missense	probably benign	0.03
R4608:Eif4g3	UTSW	4	138126458	missense	probably benign	0.03
R4658:Eif4g3	UTSW	4	138206132	missense	probably damaging	1.00
R4736:Eif4g3	UTSW	4	138198097	missense	probably benign	0.01
R4739:Eif4g3	UTSW	4	138183199	missense	possibly damaging	0.79
R4739:Eif4g3	UTSW	4	138198097	missense	probably benign	0.01
R4740:Eif4g3	UTSW	4	138198097	missense	probably benign	0.01
R4760:Eif4g3	UTSW	4	138084318	missense	possibly damaging	0.46
R4825:Eif4g3	UTSW	4	138194081	missense	probably benign
R4826:Eif4g3	UTSW	4	138177945	missense	possibly damaging	0.95
R4941:Eif4g3	UTSW	4	138170565	missense	probably damaging	1.00
R5040:Eif4g3	UTSW	4	138096889	missense	probably damaging	0.99
R5070:Eif4g3	UTSW	4	138146299	missense	probably benign	0.00
R5155:Eif4g3	UTSW	4	138126743	missense	probably benign	0.36
R5226:Eif4g3	UTSW	4	138096794	missense	possibly damaging	0.93
R5229:Eif4g3	UTSW	4	138096794	missense	possibly damaging	0.93
R5303:Eif4g3	UTSW	4	138126562	missense	probably benign	0.04
R5369:Eif4g3	UTSW	4	138183334	missense	possibly damaging	0.87
R5394:Eif4g3	UTSW	4	138103398	splice site	probably null
R5665:Eif4g3	UTSW	4	138126589	missense	probably benign	0.03
R5678:Eif4g3	UTSW	4	138151742	missense	probably damaging	0.99
R5695:Eif4g3	UTSW	4	138163433	splice site	probably null
R5704:Eif4g3	UTSW	4	138190692	missense	probably damaging	1.00
R5924:Eif4g3	UTSW	4	138201926	missense	probably damaging	1.00
R6214:Eif4g3	UTSW	4	138058003	missense	probably damaging	0.99
R6278:Eif4g3	UTSW	4	138188083	missense	possibly damaging	0.82
R6519:Eif4g3	UTSW	4	137994008	missense	probably benign
R6659:Eif4g3	UTSW	4	138177932	missense	probably damaging	1.00
R6720:Eif4g3	UTSW	4	138175832	splice site	probably null
R6812:Eif4g3	UTSW	4	138103376	missense	probably damaging	1.00
R6922:Eif4g3	UTSW	4	138097335	missense	probably damaging	1.00
R7175:Eif4g3	UTSW	4	138126215	missense	probably damaging	1.00
R7176:Eif4g3	UTSW	4	138171186	missense	probably damaging	1.00
R7598:Eif4g3	UTSW	4	138194124	missense	probably benign	0.02
R7618:Eif4g3	UTSW	4	138171118	missense	probably damaging	1.00
R7805:Eif4g3	UTSW	4	138146354	missense	probably benign	0.00
R7935:Eif4g3	UTSW	4	138096771	missense	probably damaging	1.00
R7983:Eif4g3	UTSW	4	138151593	missense	probably benign	0.00
R8261:Eif4g3	UTSW	4	138171118	missense	possibly damaging	0.46
R8371:Eif4g3	UTSW	4	138096845	missense	probably damaging	1.00
R8499:Eif4g3	UTSW	4	138165928	missense	probably damaging	1.00
R8670:Eif4g3	UTSW	4	138158512	critical splice donor site	probably null
R8672:Eif4g3	UTSW	4	138126512	missense	possibly damaging	0.75
R8744:Eif4g3	UTSW	4	137994061	small deletion	probably benign
R8767:Eif4g3	UTSW	4	138203468	missense	probably damaging	0.99
R8771:Eif4g3	UTSW	4	138180537	nonsense	probably null
R8989:Eif4g3	UTSW	4	138184748	missense	probably damaging	1.00
R9292:Eif4g3	UTSW	4	138194071	missense	possibly damaging	0.82
R9294:Eif4g3	UTSW	4	138190657	missense	probably damaging	0.98
RF008:Eif4g3	UTSW	4	138175924	missense	probably damaging	0.98
X0067:Eif4g3	UTSW	4	138163619	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCTTGTCAGAGCATTTGAGC -3'
(R):5'- TCACATGTGCCATGAGGAGG -3'

Sequencing Primer
(F):5'- TCAGAGCATTTGAGCCCCGAAG -3'
(R):5'- ACTGCTCCAACAGGGGTAG -3'

Posted On

2014-06-23