Incidental Mutation 'R0091:P2ry14'
ID20192
Institutional Source Beutler Lab
Gene Symbol P2ry14
Ensembl Gene ENSMUSG00000036381
Gene Namepurinergic receptor P2Y, G-protein coupled, 14
SynonymsGpr105, P2Y14, A330108O13Rik
MMRRC Submission 038378-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0091 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location59113855-59153618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59115893 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 49 (Y49H)
Ref Sequence ENSEMBL: ENSMUSP00000142641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000065220] [ENSMUST00000091112] [ENSMUST00000164225] [ENSMUST00000196081] [ENSMUST00000197220] [ENSMUST00000197841] [ENSMUST00000198838] [ENSMUST00000199659] [ENSMUST00000200358] [ENSMUST00000200673]
Predicted Effect probably benign
Transcript: ENSMUST00000040325
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065220
AA Change: Y49H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066669
Gene: ENSMUSG00000036381
AA Change: Y49H

DomainStartEndE-ValueType
Pfam:7tm_1 40 295 1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091112
AA Change: Y49H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088642
Gene: ENSMUSG00000036381
AA Change: Y49H

DomainStartEndE-ValueType
Pfam:7tm_1 40 295 4.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164225
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196081
AA Change: Y49H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142601
Gene: ENSMUSG00000036381
AA Change: Y49H

DomainStartEndE-ValueType
Pfam:7tm_1 40 295 1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197220
AA Change: Y49H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143070
Gene: ENSMUSG00000036381
AA Change: Y49H

DomainStartEndE-ValueType
Pfam:7tm_1 40 295 1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197841
AA Change: Y58H

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000142934
Gene: ENSMUSG00000036381
AA Change: Y58H

DomainStartEndE-ValueType
Pfam:7tm_1 49 304 1.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198838
Predicted Effect probably benign
Transcript: ENSMUST00000199659
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200358
AA Change: Y49H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000142641
Gene: ENSMUSG00000036381
AA Change: Y49H

DomainStartEndE-ValueType
Pfam:7tm_1 39 110 8.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200673
Meta Mutation Damage Score 0.1002 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.4%
  • 20x: 84.5%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of G-protein coupled receptors, which contains several receptor subtypes with different pharmacological selectivity for various adenosine and uridine nucleotides. This receptor is a P2Y purinergic receptor for UDP-glucose and other UDP-sugars coupled to G-proteins. It has been implicated in extending the known immune system functions of P2Y receptors by participating in the regulation of the stem cell compartment, and it may also play a role in neuroimmune function. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele fail to exhibit increased glucose mediated forestomach muscle tension. Mice homozygous for a different null allele show decreased gastrointestinal emptying, impaired glucose tolerance, decreased glucose-stimulated insulin release, and reduced airway responsiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,138,530 S278P possibly damaging Het
Adam11 A G 11: 102,772,839 Y281C probably damaging Het
Adam6a G T 12: 113,544,229 R74L possibly damaging Het
Adcy5 T C 16: 35,270,998 probably null Het
Adrb2 A G 18: 62,179,019 L245P probably benign Het
Aebp2 T C 6: 140,644,074 probably null Het
Arhgap23 A G 11: 97,452,244 T240A probably benign Het
Atp10a T C 7: 58,774,046 probably benign Het
Atp13a4 T A 16: 29,455,395 Y416F probably damaging Het
Atp5g2 A C 15: 102,663,057 L133R probably damaging Het
Bicral A T 17: 46,825,307 Y326N probably damaging Het
Chst4 T C 8: 110,030,665 S189G probably damaging Het
Cnot1 A T 8: 95,763,144 I477N probably damaging Het
Col7a1 G T 9: 108,967,506 probably benign Het
Dchs1 A G 7: 105,766,094 probably benign Het
Dcn A G 10: 97,506,689 N169S probably benign Het
Dnajc6 T C 4: 101,616,777 probably benign Het
Egln3 A G 12: 54,181,646 F225L probably benign Het
Erap1 G A 13: 74,668,052 R100Q possibly damaging Het
Erc2 A T 14: 27,776,824 probably null Het
Fto G A 8: 91,441,807 probably null Het
Gdap1l1 C T 2: 163,446,091 P80S probably damaging Het
Gm1123 T C 9: 99,023,352 E35G possibly damaging Het
Hhipl1 A G 12: 108,321,897 probably benign Het
Ift80 A T 3: 68,914,675 L679Q probably damaging Het
Il18 A G 9: 50,576,713 probably benign Het
Inhbb T C 1: 119,417,395 Y388C probably damaging Het
Kmt2d G T 15: 98,844,479 probably benign Het
Krt20 A G 11: 99,437,814 V95A probably damaging Het
Lck A T 4: 129,555,681 S274R possibly damaging Het
Lrp1 T A 10: 127,540,979 N4243I probably damaging Het
Lrrfip2 G A 9: 111,214,243 V506I probably damaging Het
Ltbp2 A G 12: 84,793,733 C1000R probably damaging Het
Matn3 G A 12: 8,952,105 D106N probably damaging Het
Micalcl A G 7: 112,381,296 E49G probably benign Het
Mmadhc A G 2: 50,292,857 S36P probably damaging Het
Morn1 T C 4: 155,145,172 Y433H probably damaging Het
Mpo A G 11: 87,801,610 M525V probably benign Het
Myo5a C T 9: 75,161,492 R659C probably damaging Het
Obox6 T C 7: 15,834,439 S171G probably benign Het
Olfr1280 T A 2: 111,316,173 D231E probably benign Het
Olfr347 A G 2: 36,734,905 N195D probably damaging Het
Olfr998 A T 2: 85,591,352 N271Y probably benign Het
Papss2 C T 19: 32,633,902 T17I possibly damaging Het
Pcid2 T C 8: 13,085,392 T206A probably benign Het
Pex6 A G 17: 46,711,918 E140G probably damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prdx2 T G 8: 84,971,701 probably benign Het
Ptbp2 A T 3: 119,720,661 L471Q probably damaging Het
Rbm33 T A 5: 28,352,606 D232E possibly damaging Het
Rnf214 T A 9: 45,898,493 probably null Het
Rora G A 9: 69,374,048 R314H probably damaging Het
Rufy4 T C 1: 74,128,936 probably benign Het
Sag T C 1: 87,814,680 V58A probably damaging Het
Serpina3i C T 12: 104,265,164 T20M probably damaging Het
Slc4a5 A G 6: 83,277,555 N578S probably benign Het
Soat2 A G 15: 102,158,139 Y285C probably damaging Het
Syk A G 13: 52,640,733 Y478C probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tas2r126 A T 6: 42,435,102 M190L probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttc19 A G 11: 62,309,084 D218G probably damaging Het
Tut1 T C 19: 8,965,436 V629A probably damaging Het
Txndc11 T C 16: 11,088,104 N521D probably benign Het
Ushbp1 T C 8: 71,388,970 E405G possibly damaging Het
Usp46 C T 5: 74,003,257 R246Q probably benign Het
Utrn T C 10: 12,735,204 D469G probably damaging Het
Vmn2r104 T A 17: 20,041,813 I352F possibly damaging Het
Wdr4 G A 17: 31,496,916 T398I probably benign Het
Ythdc1 T A 5: 86,820,701 probably benign Het
Other mutations in P2ry14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:P2ry14 APN 3 59115335 missense probably damaging 1.00
R0511:P2ry14 UTSW 3 59116028 missense possibly damaging 0.89
R0518:P2ry14 UTSW 3 59115204 missense probably damaging 1.00
R0638:P2ry14 UTSW 3 59115448 missense probably benign 0.00
R1167:P2ry14 UTSW 3 59115131 missense probably damaging 0.99
R1540:P2ry14 UTSW 3 59115265 missense probably benign 0.08
R1795:P2ry14 UTSW 3 59115853 missense probably damaging 1.00
R2025:P2ry14 UTSW 3 59115445 missense probably damaging 1.00
R2096:P2ry14 UTSW 3 59115317 missense probably damaging 1.00
R2265:P2ry14 UTSW 3 59115571 missense probably damaging 1.00
R2266:P2ry14 UTSW 3 59115571 missense probably damaging 1.00
R2267:P2ry14 UTSW 3 59115571 missense probably damaging 1.00
R4664:P2ry14 UTSW 3 59115142 missense probably damaging 1.00
R5294:P2ry14 UTSW 3 59115568 missense possibly damaging 0.93
R5721:P2ry14 UTSW 3 59115031 splice site probably null
R5969:P2ry14 UTSW 3 59115158 missense probably damaging 1.00
R6077:P2ry14 UTSW 3 59115377 missense probably damaging 0.99
R6619:P2ry14 UTSW 3 59115733 missense probably damaging 1.00
R7222:P2ry14 UTSW 3 59115382 missense probably benign 0.00
R7452:P2ry14 UTSW 3 59116045 missense probably benign
R8092:P2ry14 UTSW 3 59115446 missense probably damaging 1.00
R8698:P2ry14 UTSW 3 59115175 missense possibly damaging 0.78
RF017:P2ry14 UTSW 3 59115046 missense probably benign 0.03
Z1176:P2ry14 UTSW 3 59115737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGAAGATATTGCGGCTGGAC -3'
(R):5'- TGCCTCCAGAGGTGAGAAGATGAAC -3'

Sequencing Primer
(F):5'- TACCTGTCAAAGCTGATGAGC -3'
(R):5'- GTGAGAAGATGAACAACTCCAC -3'
Posted On2013-04-11