Incidental Mutation 'R1793:Arap1'
ID 201937
Institutional Source Beutler Lab
Gene Symbol Arap1
Ensembl Gene ENSMUSG00000032812
Gene Name ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
Synonyms Centd2, 2410002L19Rik
MMRRC Submission 039823-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1793 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 101348067-101412586 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 101388622 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 477 (H477Q)
Ref Sequence ENSEMBL: ENSMUSP00000102624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084895] [ENSMUST00000084896] [ENSMUST00000107010] [ENSMUST00000127873] [ENSMUST00000130016] [ENSMUST00000134143] [ENSMUST00000141083] [ENSMUST00000148902]
AlphaFold Q4LDD4
Predicted Effect probably benign
Transcript: ENSMUST00000084895
AA Change: H229Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081957
Gene: ENSMUSG00000032812
AA Change: H229Q

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
PH 82 175 2.62e-17 SMART
PH 195 285 3.6e-6 SMART
ArfGap 289 415 2.4e-22 SMART
PH 498 606 1.23e-13 SMART
PH 616 710 1.08e0 SMART
RhoGAP 722 904 1.35e-63 SMART
Pfam:RA 926 1015 1.5e-10 PFAM
PH 1029 1141 8.58e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084896
AA Change: H477Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081958
Gene: ENSMUSG00000032812
AA Change: H477Q

DomainStartEndE-ValueType
SAM 3 70 1.72e-7 SMART
low complexity region 92 104 N/A INTRINSIC
low complexity region 115 126 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
low complexity region 197 227 N/A INTRINSIC
low complexity region 267 285 N/A INTRINSIC
PH 330 423 2.62e-17 SMART
PH 443 533 3.6e-6 SMART
ArfGap 537 663 2.4e-22 SMART
PH 746 854 1.23e-13 SMART
PH 864 958 1.08e0 SMART
RhoGAP 970 1152 1.35e-63 SMART
Pfam:RA 1174 1263 6.6e-13 PFAM
PH 1277 1400 8e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107010
AA Change: H477Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102624
Gene: ENSMUSG00000032812
AA Change: H477Q

DomainStartEndE-ValueType
SAM 3 70 1.72e-7 SMART
low complexity region 92 104 N/A INTRINSIC
low complexity region 115 126 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
low complexity region 197 227 N/A INTRINSIC
low complexity region 267 285 N/A INTRINSIC
PH 330 423 2.62e-17 SMART
PH 443 533 3.6e-6 SMART
ArfGap 537 663 2.4e-22 SMART
PH 746 854 1.23e-13 SMART
PH 864 958 1.08e0 SMART
RhoGAP 970 1152 1.35e-63 SMART
Pfam:RA 1174 1263 1.9e-10 PFAM
PH 1277 1389 8.58e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127873
SMART Domains Protein: ENSMUSP00000121257
Gene: ENSMUSG00000032812

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130016
SMART Domains Protein: ENSMUSP00000115850
Gene: ENSMUSG00000032812

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134143
SMART Domains Protein: ENSMUSP00000115107
Gene: ENSMUSG00000032812

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
SCOP:d1ki1b2 68 111 4e-4 SMART
Blast:PH 82 111 6e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000141083
Predicted Effect probably benign
Transcript: ENSMUST00000148902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213314
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency 100% (122/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains SAM, ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology (PH) domains. In vitro, this protein displays RHO-GAP and phosphatidylinositol (3,4,5) trisphosphate (PIP3)-dependent ARF-GAP activity. The encoded protein associates with the Golgi, and the ARF-GAP activity mediates changes in the Golgi and the formation of filopodia. It is thought to regulate the cell-specific trafficking of a receptor protein involved in apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,278 H571Q probably damaging Het
Abcf2 T A 5: 24,568,776 M372L probably benign Het
Acaca A C 11: 84,315,969 T1552P probably damaging Het
Acaca A G 11: 84,338,393 D1682G probably damaging Het
Acvr1b T C 15: 101,194,025 V62A probably benign Het
Aimp1 C T 3: 132,674,064 V97M probably benign Het
Aldh1l1 C T 6: 90,577,831 T557I possibly damaging Het
Alpk1 T C 3: 127,677,798 T1012A probably damaging Het
Amot G A X: 145,450,589 probably benign Het
Arhgap18 T A 10: 26,860,736 probably benign Het
Arhgef10l C T 4: 140,515,373 V862M probably damaging Het
Arl4d A G 11: 101,666,728 I27V probably benign Het
Asb18 G A 1: 90,014,555 P8L probably damaging Het
Ash1l A G 3: 89,070,309 H2682R probably damaging Het
Aspm T A 1: 139,457,341 V241E probably benign Het
Atf7ip G T 6: 136,609,219 probably benign Het
AY358078 T G 14: 51,804,594 M142R unknown Het
C3 T A 17: 57,219,592 K796N possibly damaging Het
Cd3eap T C 7: 19,357,979 T68A possibly damaging Het
Ceacam16 T C 7: 19,856,116 T301A probably damaging Het
Ceacam5 T G 7: 17,747,395 Y356D probably benign Het
Cep192 C T 18: 67,851,767 A1616V possibly damaging Het
Cherp A T 8: 72,463,150 H645Q probably benign Het
CK137956 T C 4: 127,951,449 D167G probably benign Het
Clcn1 T A 6: 42,298,926 probably null Het
Cntn1 C T 15: 92,291,671 T625I possibly damaging Het
Cpn2 T A 16: 30,259,324 N520Y probably damaging Het
Crocc G A 4: 141,019,309 R1762W probably damaging Het
Cts3 C A 13: 61,568,153 V100F probably benign Het
Ddx56 A T 11: 6,266,934 V87D probably damaging Het
Dnah9 C T 11: 66,119,594 probably null Het
Dock1 T A 7: 135,098,727 probably null Het
Dst T A 1: 34,152,471 Y291* probably null Het
Eif4g3 T C 4: 138,171,131 I1071T probably damaging Het
Fblim1 T C 4: 141,595,238 Q78R probably damaging Het
Fcamr C T 1: 130,811,547 P195S probably benign Het
Fcho1 G A 8: 71,709,022 Q835* probably null Het
Frem3 A G 8: 80,613,112 N678S probably benign Het
Frk G A 10: 34,607,882 R413H probably benign Het
Gm10619 C A 7: 73,810,010 noncoding transcript Het
Gm12185 G A 11: 48,915,756 R203* probably null Het
Gm12886 A G 4: 121,422,977 V34A probably benign Het
Gna12 A T 5: 140,760,952 I246N probably damaging Het
Gpm6a T C 8: 55,054,832 M201T probably benign Het
Gpsm2 T G 3: 108,700,909 D220A probably benign Het
Grip2 C G 6: 91,783,642 V325L probably benign Het
Grk5 C A 19: 61,076,762 A288D probably damaging Het
Herpud2 G A 9: 25,110,657 A231V possibly damaging Het
Hmcn1 T C 1: 150,749,083 S1024G probably benign Het
Hp1bp3 A G 4: 138,230,509 D295G probably damaging Het
Igsf21 T C 4: 140,034,392 H325R probably damaging Het
Ing2 T A 8: 47,669,329 L61F probably damaging Het
Jak3 T C 8: 71,685,946 probably benign Het
Kcnn3 T A 3: 89,609,405 C374S probably benign Het
Klk1b22 A G 7: 44,116,351 probably benign Het
Larp1 T C 11: 58,049,938 M630T possibly damaging Het
Lhx5 T A 5: 120,434,660 C115S probably damaging Het
Lmcd1 C A 6: 112,328,751 T271K probably benign Het
Lpar1 G A 4: 58,486,798 R158* probably null Het
Lyst T A 13: 13,647,083 C1347* probably null Het
Maats1 T A 16: 38,321,419 N384Y possibly damaging Het
Map3k8 G A 18: 4,332,389 Q441* probably null Het
Mboat1 T C 13: 30,219,650 V144A probably damaging Het
Mcur1 C T 13: 43,560,015 G38S unknown Het
Med13 T A 11: 86,329,351 M276L probably benign Het
Mefv A G 16: 3,708,664 S699P possibly damaging Het
Mfsd4a C A 1: 132,059,339 A62S probably damaging Het
Mmp27 A G 9: 7,571,458 M1V probably null Het
Myo1c C T 11: 75,657,589 T58I probably damaging Het
Myom3 A T 4: 135,810,755 D1316V probably benign Het
Naa25 T A 5: 121,417,415 C235S possibly damaging Het
Naa25 C A 5: 121,420,593 R333S probably damaging Het
Nav3 G A 10: 109,703,372 T2056I probably benign Het
Nol4 A G 18: 22,769,821 Y378H probably damaging Het
Npat G A 9: 53,552,289 R124Q probably damaging Het
Npr3 T A 15: 11,848,579 E434V probably benign Het
Nptx2 A G 5: 144,548,320 T208A probably benign Het
Obscn C T 11: 59,077,780 V2798M probably damaging Het
Olfr1406 A T 1: 173,184,409 H8Q probably benign Het
Olfr1484 C T 19: 13,585,415 T37I probably benign Het
Olfr569 A G 7: 102,888,043 Y37H probably benign Het
Padi1 G A 4: 140,814,656 P652S probably damaging Het
Pcdh1 G T 18: 38,198,885 P355Q probably damaging Het
Pck2 G A 14: 55,543,965 R189H possibly damaging Het
Pcsk5 T A 19: 17,454,750 K1500N possibly damaging Het
Phc3 A T 3: 30,948,716 S218T probably damaging Het
Piezo2 T A 18: 63,106,284 M510L possibly damaging Het
Ppp1r3a A T 6: 14,754,718 Y177N probably damaging Het
Psme2b A T 11: 48,945,534 D195E probably damaging Het
Ptprr T C 10: 116,252,922 V463A probably damaging Het
Pwwp2b G A 7: 139,256,365 R574Q probably damaging Het
Rap1gds1 T A 3: 139,050,553 T14S possibly damaging Het
Rbm11 A T 16: 75,600,797 K205M probably damaging Het
Rfx1 T A 8: 84,066,421 probably benign Het
Rnasel C A 1: 153,754,423 H228Q probably damaging Het
Sap130 T A 18: 31,698,587 I710K probably benign Het
Slc27a4 C A 2: 29,805,721 D89E probably benign Het
Spata31d1b T C 13: 59,715,965 V309A probably benign Het
Syt7 T G 19: 10,443,990 Y420D probably damaging Het
Tanc2 A G 11: 105,625,033 probably null Het
Tbc1d10b A G 7: 127,203,758 S333P possibly damaging Het
Tenm2 G A 11: 36,023,382 P2442S probably damaging Het
Tenm3 C T 8: 48,674,544 C33Y probably damaging Het
Timmdc1 A G 16: 38,499,057 L245P possibly damaging Het
Tlr5 T C 1: 182,972,447 F5L probably benign Het
Ttc25 C A 11: 100,569,853 probably null Het
Ttll4 T A 1: 74,687,840 F784L possibly damaging Het
Tulp4 A G 17: 6,139,112 T70A possibly damaging Het
Txndc17 T A 11: 72,208,745 N81K probably benign Het
Ubr3 C T 2: 70,000,551 probably benign Het
Uri1 A C 7: 37,981,691 V96G probably damaging Het
Uspl1 T A 5: 149,213,436 I482N probably damaging Het
Vmn1r229 A G 17: 20,814,712 N73S possibly damaging Het
Vwa7 G T 17: 35,024,412 G689* probably null Het
Zfp114 T A 7: 24,177,739 probably null Het
Zfp618 A G 4: 63,133,237 S659G probably damaging Het
Zfp872 A G 9: 22,200,053 K275R probably damaging Het
Zzef1 C T 11: 72,886,709 P1789S probably damaging Het
Other mutations in Arap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Arap1 APN 7 101388049 missense probably damaging 0.96
IGL01311:Arap1 APN 7 101388136 nonsense probably null
IGL01349:Arap1 APN 7 101387152 missense possibly damaging 0.84
IGL01521:Arap1 APN 7 101400605 critical splice donor site probably null
IGL01869:Arap1 APN 7 101400283 missense probably damaging 1.00
IGL02156:Arap1 APN 7 101388730 unclassified probably benign
IGL02320:Arap1 APN 7 101385029 missense probably benign
IGL02478:Arap1 APN 7 101400125 splice site probably null
R0133:Arap1 UTSW 7 101386229 missense probably damaging 0.98
R0233:Arap1 UTSW 7 101400241 missense possibly damaging 0.47
R0233:Arap1 UTSW 7 101400241 missense possibly damaging 0.47
R0412:Arap1 UTSW 7 101390222 missense probably damaging 0.98
R0616:Arap1 UTSW 7 101401650 missense possibly damaging 0.64
R0838:Arap1 UTSW 7 101400412 missense probably damaging 1.00
R0962:Arap1 UTSW 7 101384914 missense possibly damaging 0.56
R1186:Arap1 UTSW 7 101404269 splice site probably benign
R1405:Arap1 UTSW 7 101398436 splice site probably null
R1405:Arap1 UTSW 7 101398436 splice site probably null
R1724:Arap1 UTSW 7 101400526 missense possibly damaging 0.91
R1959:Arap1 UTSW 7 101373015 missense probably damaging 1.00
R1960:Arap1 UTSW 7 101373015 missense probably damaging 1.00
R2020:Arap1 UTSW 7 101401518 missense probably benign 0.00
R2128:Arap1 UTSW 7 101409320 missense probably damaging 1.00
R3737:Arap1 UTSW 7 101400277 missense possibly damaging 0.85
R3851:Arap1 UTSW 7 101390165 nonsense probably null
R4034:Arap1 UTSW 7 101400277 missense possibly damaging 0.85
R4386:Arap1 UTSW 7 101385571 missense probably benign
R4435:Arap1 UTSW 7 101390254 missense possibly damaging 0.74
R4779:Arap1 UTSW 7 101404367 missense probably damaging 1.00
R4786:Arap1 UTSW 7 101385005 missense possibly damaging 0.94
R4850:Arap1 UTSW 7 101398791 missense probably damaging 1.00
R4942:Arap1 UTSW 7 101401802 missense possibly damaging 0.95
R5253:Arap1 UTSW 7 101388644 missense probably benign 0.00
R5342:Arap1 UTSW 7 101404960 missense probably benign 0.00
R5367:Arap1 UTSW 7 101409130 missense probably damaging 0.99
R5397:Arap1 UTSW 7 101384912 missense possibly damaging 0.95
R5968:Arap1 UTSW 7 101394738 missense probably damaging 1.00
R6052:Arap1 UTSW 7 101404033 missense probably damaging 1.00
R6574:Arap1 UTSW 7 101404001 missense probably damaging 1.00
R6645:Arap1 UTSW 7 101408111 missense possibly damaging 0.57
R7060:Arap1 UTSW 7 101409357 splice site probably null
R7191:Arap1 UTSW 7 101384992 missense probably benign 0.31
R7323:Arap1 UTSW 7 101400211 missense probably damaging 1.00
R7349:Arap1 UTSW 7 101390228 missense possibly damaging 0.95
R7516:Arap1 UTSW 7 101409331 missense probably benign 0.00
R7922:Arap1 UTSW 7 101404414 nonsense probably null
R8034:Arap1 UTSW 7 101394773 missense probably damaging 1.00
R8293:Arap1 UTSW 7 101400934 missense probably benign
R8493:Arap1 UTSW 7 101386518 nonsense probably null
R8810:Arap1 UTSW 7 101404378 missense probably damaging 0.99
R8811:Arap1 UTSW 7 101387196 missense probably damaging 1.00
R8928:Arap1 UTSW 7 101408117 missense possibly damaging 0.52
R8930:Arap1 UTSW 7 101408117 missense possibly damaging 0.52
R8931:Arap1 UTSW 7 101408117 missense possibly damaging 0.52
R8941:Arap1 UTSW 7 101408117 missense possibly damaging 0.52
R9014:Arap1 UTSW 7 101404333 missense probably damaging 1.00
R9144:Arap1 UTSW 7 101398395 missense probably damaging 1.00
R9164:Arap1 UTSW 7 101391883 nonsense probably null
R9215:Arap1 UTSW 7 101400007 missense probably benign 0.23
R9340:Arap1 UTSW 7 101388175 missense probably damaging 1.00
R9519:Arap1 UTSW 7 101394739 start gained probably benign
R9790:Arap1 UTSW 7 101388169 missense probably benign 0.00
R9791:Arap1 UTSW 7 101388169 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCATCCTGTCCCTGAACAG -3'
(R):5'- AGACGTCTGGCAGACTAAGG -3'

Sequencing Primer
(F):5'- TGTCCCTGAACAGCACCC -3'
(R):5'- CTAAGGCAGGTGGGTGAGC -3'
Posted On 2014-06-23