Incidental Mutation 'R0091:Ptbp2'
ID20194
Institutional Source Beutler Lab
Gene Symbol Ptbp2
Ensembl Gene ENSMUSG00000028134
Gene Namepolypyrimidine tract binding protein 2
SynonymsbrPTB
MMRRC Submission 038378-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0091 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location119718742-119784466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119720661 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 471 (L471Q)
Ref Sequence ENSEMBL: ENSMUSP00000143510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029780] [ENSMUST00000195902] [ENSMUST00000197387] [ENSMUST00000197833] [ENSMUST00000200097]
Predicted Effect probably damaging
Transcript: ENSMUST00000029780
AA Change: L471Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029780
Gene: ENSMUSG00000028134
AA Change: L471Q

DomainStartEndE-ValueType
RRM 60 129 3.8e-6 SMART
low complexity region 144 159 N/A INTRINSIC
RRM 182 251 1.22e-4 SMART
low complexity region 285 295 N/A INTRINSIC
RRM 339 408 1.07e-9 SMART
RRM 456 526 1.99e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195902
SMART Domains Protein: ENSMUSP00000143325
Gene: ENSMUSG00000028134

DomainStartEndE-ValueType
Blast:RRM_2 1 48 7e-25 BLAST
PDB:1SJR|A 1 48 3e-27 PDB
low complexity region 49 59 N/A INTRINSIC
Pfam:RRM_1 109 154 1.9e-4 PFAM
Pfam:RRM_6 109 155 1.4e-6 PFAM
Pfam:RRM_5 124 155 2.6e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196203
Predicted Effect probably benign
Transcript: ENSMUST00000197387
Predicted Effect probably benign
Transcript: ENSMUST00000197833
SMART Domains Protein: ENSMUSP00000143719
Gene: ENSMUSG00000028134

DomainStartEndE-ValueType
RRM 60 129 1.7e-8 SMART
low complexity region 144 159 N/A INTRINSIC
RRM 182 251 5.2e-7 SMART
low complexity region 285 295 N/A INTRINSIC
PDB:2MJU|A 325 349 4e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198733
Predicted Effect probably damaging
Transcript: ENSMUST00000200097
AA Change: L471Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143510
Gene: ENSMUSG00000028134
AA Change: L471Q

DomainStartEndE-ValueType
RRM 60 129 3.8e-6 SMART
low complexity region 144 159 N/A INTRINSIC
RRM 182 251 1.22e-4 SMART
low complexity region 285 295 N/A INTRINSIC
RRM 339 408 1.07e-9 SMART
RRM 456 525 8.08e-10 SMART
Meta Mutation Damage Score 0.8322 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.4%
  • 20x: 84.5%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to intronic polypyrimidine clusters in pre-mRNA molecules and is implicated in controlling the assembly of other splicing-regulatory proteins. This protein is very similar to the polypyrimidine tract binding protein (PTB) but most of its isoforms are expressed primarily in the brain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality with premature neurogenesis and abnormal neural stem cell polarity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,138,530 S278P possibly damaging Het
Adam11 A G 11: 102,772,839 Y281C probably damaging Het
Adam6a G T 12: 113,544,229 R74L possibly damaging Het
Adcy5 T C 16: 35,270,998 probably null Het
Adrb2 A G 18: 62,179,019 L245P probably benign Het
Aebp2 T C 6: 140,644,074 probably null Het
Arhgap23 A G 11: 97,452,244 T240A probably benign Het
Atp10a T C 7: 58,774,046 probably benign Het
Atp13a4 T A 16: 29,455,395 Y416F probably damaging Het
Atp5g2 A C 15: 102,663,057 L133R probably damaging Het
Bicral A T 17: 46,825,307 Y326N probably damaging Het
Chst4 T C 8: 110,030,665 S189G probably damaging Het
Cnot1 A T 8: 95,763,144 I477N probably damaging Het
Col7a1 G T 9: 108,967,506 probably benign Het
Dchs1 A G 7: 105,766,094 probably benign Het
Dcn A G 10: 97,506,689 N169S probably benign Het
Dnajc6 T C 4: 101,616,777 probably benign Het
Egln3 A G 12: 54,181,646 F225L probably benign Het
Erap1 G A 13: 74,668,052 R100Q possibly damaging Het
Erc2 A T 14: 27,776,824 probably null Het
Fto G A 8: 91,441,807 probably null Het
Gdap1l1 C T 2: 163,446,091 P80S probably damaging Het
Gm1123 T C 9: 99,023,352 E35G possibly damaging Het
Hhipl1 A G 12: 108,321,897 probably benign Het
Ift80 A T 3: 68,914,675 L679Q probably damaging Het
Il18 A G 9: 50,576,713 probably benign Het
Inhbb T C 1: 119,417,395 Y388C probably damaging Het
Kmt2d G T 15: 98,844,479 probably benign Het
Krt20 A G 11: 99,437,814 V95A probably damaging Het
Lck A T 4: 129,555,681 S274R possibly damaging Het
Lrp1 T A 10: 127,540,979 N4243I probably damaging Het
Lrrfip2 G A 9: 111,214,243 V506I probably damaging Het
Ltbp2 A G 12: 84,793,733 C1000R probably damaging Het
Matn3 G A 12: 8,952,105 D106N probably damaging Het
Micalcl A G 7: 112,381,296 E49G probably benign Het
Mmadhc A G 2: 50,292,857 S36P probably damaging Het
Morn1 T C 4: 155,145,172 Y433H probably damaging Het
Mpo A G 11: 87,801,610 M525V probably benign Het
Myo5a C T 9: 75,161,492 R659C probably damaging Het
Obox6 T C 7: 15,834,439 S171G probably benign Het
Olfr1280 T A 2: 111,316,173 D231E probably benign Het
Olfr347 A G 2: 36,734,905 N195D probably damaging Het
Olfr998 A T 2: 85,591,352 N271Y probably benign Het
P2ry14 A G 3: 59,115,893 Y49H probably benign Het
Papss2 C T 19: 32,633,902 T17I possibly damaging Het
Pcid2 T C 8: 13,085,392 T206A probably benign Het
Pex6 A G 17: 46,711,918 E140G probably damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prdx2 T G 8: 84,971,701 probably benign Het
Rbm33 T A 5: 28,352,606 D232E possibly damaging Het
Rnf214 T A 9: 45,898,493 probably null Het
Rora G A 9: 69,374,048 R314H probably damaging Het
Rufy4 T C 1: 74,128,936 probably benign Het
Sag T C 1: 87,814,680 V58A probably damaging Het
Serpina3i C T 12: 104,265,164 T20M probably damaging Het
Slc4a5 A G 6: 83,277,555 N578S probably benign Het
Soat2 A G 15: 102,158,139 Y285C probably damaging Het
Syk A G 13: 52,640,733 Y478C probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tas2r126 A T 6: 42,435,102 M190L probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttc19 A G 11: 62,309,084 D218G probably damaging Het
Tut1 T C 19: 8,965,436 V629A probably damaging Het
Txndc11 T C 16: 11,088,104 N521D probably benign Het
Ushbp1 T C 8: 71,388,970 E405G possibly damaging Het
Usp46 C T 5: 74,003,257 R246Q probably benign Het
Utrn T C 10: 12,735,204 D469G probably damaging Het
Vmn2r104 T A 17: 20,041,813 I352F possibly damaging Het
Wdr4 G A 17: 31,496,916 T398I probably benign Het
Ythdc1 T A 5: 86,820,701 probably benign Het
Other mutations in Ptbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Ptbp2 APN 3 119747812 missense probably damaging 1.00
IGL01874:Ptbp2 APN 3 119747800 missense probably damaging 1.00
IGL01940:Ptbp2 APN 3 119726115 missense possibly damaging 0.46
IGL02094:Ptbp2 APN 3 119752940 splice site probably benign
IGL02374:Ptbp2 APN 3 119720693 splice site probably benign
IGL02523:Ptbp2 APN 3 119740487 nonsense probably null
IGL02879:Ptbp2 APN 3 119740405 missense probably damaging 1.00
IGL03149:Ptbp2 APN 3 119720425 missense possibly damaging 0.86
IGL03153:Ptbp2 APN 3 119751944 missense probably benign 0.04
IGL03391:Ptbp2 APN 3 119720382 nonsense probably null
R0067:Ptbp2 UTSW 3 119720641 missense probably benign 0.00
R0067:Ptbp2 UTSW 3 119720641 missense probably benign 0.00
R0396:Ptbp2 UTSW 3 119724198 splice site probably benign
R0511:Ptbp2 UTSW 3 119720964 missense probably benign
R0722:Ptbp2 UTSW 3 119720921 missense possibly damaging 0.72
R1573:Ptbp2 UTSW 3 119753105 missense probably damaging 1.00
R1907:Ptbp2 UTSW 3 119761749 missense probably damaging 1.00
R3606:Ptbp2 UTSW 3 119747632 missense probably damaging 1.00
R5082:Ptbp2 UTSW 3 119752964 missense probably benign 0.06
R5575:Ptbp2 UTSW 3 119720783 splice site probably null
R5575:Ptbp2 UTSW 3 119720789 missense possibly damaging 0.86
R5655:Ptbp2 UTSW 3 119724157 missense probably benign 0.44
R5836:Ptbp2 UTSW 3 119726097 missense probably damaging 0.98
R6290:Ptbp2 UTSW 3 119724120 missense possibly damaging 0.50
R6364:Ptbp2 UTSW 3 119740442 missense probably damaging 1.00
R6398:Ptbp2 UTSW 3 119720835 missense probably benign 0.23
R6574:Ptbp2 UTSW 3 119747947 missense probably damaging 0.99
R7037:Ptbp2 UTSW 3 119751908 missense probably damaging 1.00
R7243:Ptbp2 UTSW 3 119753112 missense possibly damaging 0.47
R7718:Ptbp2 UTSW 3 119720988 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTTGCCATCTGAAGAAGAGCC -3'
(R):5'- TTGGGAATTCACCACTGCACCG -3'

Sequencing Primer
(F):5'- GCCATCTGAAGAAGAGCCATTTTG -3'
(R):5'- AAAACTTTCAGAACATTTTCCCTCC -3'
Posted On2013-04-11